Contact us
닫기
Article Search
닫기

Microbiology and Biotechnology Letters

보문(Article)

View PDF

Fermentation Microbiology (FM)  |  Host-Microbe Interaction and Pathogenesis

Microbiol. Biotechnol. Lett. 2022; 50(4): 574-583

https://doi.org/10.48022/mbl.2206.06004

Received: June 8, 2022; Revised: August 29, 2022; Accepted: August 30, 2022

Ficus vasculosa Wall. ex Miq. Inhibits the LPS-Induced Inflammation in RAW264.7 Macrophages

Ji-Won Park1†, Jin-Mi Park1,2†, Sangmi Eum3, Jung Hee Kim1, Jae Hoon Oh1,2, Jinseon Choi1,2, Tran The Bach4, Nguyen Van Sinh4, Sangho Choi3*, Kyung-Seop Ahn1*, and Jae-Won Lee1*

1Natural Medicine Research Center, Korea Research Institute of Bioscience and Biotechnology, Cheongju 28116, Republic of Korea
2College of Pharmacy, Chungbuk National University, Cheongju 28160, Republic of Korea
3International Biological Material Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon 34141, Republic of Korea
4Institute of Ecology and Biological Resources, Vietnam Academy of Science and Technology, 18 Hoang Quoc Viet, Cau Giay, Ha Noi, Vietnam

Correspondence to :
S. Choi,        decoy0@kribb.re.kr
K.-S. Ahn,     ksahn@kribb.re.kr
J.-W. Lee,     suc369@kribb.re.kr, suc369@kangwon.ac.kr
+These authors contributed equally to this work.

Abstract

Go to

Ficus vasculosa Wall. ex Miq. (FV) has been used as a herbal medicine in Southeast Asia and its antioxidant activity has been shown in previous studies. However, it has not yet been elucidated whether FV exerts anti-inflammatory effects on activated-macrophages. Thus, we aimed to evaluate the ameliorative property of FV methanol extract (FM) on lipopolysaccharide (LPS)-induced inflammatory responses and the underlying molecular mechanisms in RAW264.7 macrophages. The experimental results indicated that FM decreased the production of inflammatory mediators (NO/PGE2) and the mRNA/protein expression of iNOS and COX-2 in LPS-stimulated RAW264.7 cells. FM also reduced the secretion of interleukin (IL)-1β, IL-6, tumor necrosis factor (TNF)-α and monocyte chemoattractant protein (MCP)-1 in LPS-stimulated RAW264.7 cells. Results also demonstrated that FM improved inflammatory response in LPS-stimulated A549 airway epithelial cells by inhibiting the production of cytokines, such as IL-1β, IL-6 and TNF-α. In addition, FM suppressed MAPK activation and NF-κB nuclear translocation induced by LPS. FM also upregulated the mRNA/protein expression levels of heme oxygenase-1 and the nuclear translocation of nuclear factor erythroid 2-related factor 2 in RAW264.7 cells. In an experimental animal model of LPS-induced acute lung injury, the increased levels of molecules in bronchoalveolar lavage (BAL) fluid were suppressed by FM administration. Collectively, it was founded that FM has anti-inflammatory properties on activated-macrophages by suppressing inflammatory molecules and regulating the activation of MAPK/NF-κB signaling.

Keywords: Ficus vasculosa Wall. ex Miq., macrophages, lipopolysaccharide, inflammation, NF-κB

Graphical Abstract


Introduction

Go to

Macrophages exert protective effects against bacterial infections in systemic biology [1]. However, the uncontrolled production of these cell-derived molecules induces hyper-inflammation. Macrophage-derived nitric oxide (NO), inducible NO synthase (iNOS), cyclooxygenase-2 (COX-2) and prostaglandin E2 (PGE2) lead to acute inflammation in sepsis, acute lung injury (ALI) and acute respiratory distress syndrome (ARDS) [2, 3]. The increased levels of interleukin-1β (IL-1β), IL-6, tumor necrosis factor-α (TNF-α) and monocyte chemoattractant protein-1 (MCP-1) are representative markers of ALI/ ARDS [4, 5]; the significant increase in the levels of these molecules has been demonstrated in both in vitro and in vivo studies on LPS-induced ALI/ARDS [6−8]. It was founded that airway epithelial cell-derived cytokines, such as (IL-1β), IL-6 and TNF-α promote inflammatory response in ALI [9, 10]. Lipopolysaccharide (LPS) has been administered to RAW264.7 macrophages and mice for the study of acute lung inflammation [11, 12]. There is cumulative evidence to indicate that the MAPK and NF-κB signaling pathways are related to the expression of inflammatory molecules (cytokines, chemokines and mediators) [8, 13, 14]. Studies showed that heme oxygenase 1 (HO-1) induction may ameliorate the inflammatory response by affecting MAPK or NF-κB phosphorylation and the generation of molecules, such as cytokines [15−17].

Researchers have focused on the various biological effects and the limited side-effects of natural products (NPs) in amelioration of pulmonary disorders [18−20]. Ficus vasculosa Wall. ex Miq, a species of plant in the Moraceae family, has been used to treat belly pain and diarrhea in China [21] and lung disease, abdominal pain, goiter and leukoplakia in Vietman [22]. The in vitro experimental results from Shi et al. indicated that the leaves of F. vasculosa (FV) show antioxidant activities against ABTS and DPPH radical scavenging [23]. A previous study revealed that methyl p-hydroxcinamic compound, which is isolated from FV, exerts antibacterial effects [24]. However, its anti-inflammatory properties were not confirmed in activated-macrophages. Thus, the present study evaluated the ameliorative effects of FV methanol extract (FM) on inflammatory response in activated-macrophages.

Materials and Methods

Go to

Chemicals and reagents

Lipopolysaccharide from E. Coli O111:B4 was purchased from Sigma-Aldrich (USA). DMEM, RPMI 1640 and FBS were obtained from Welgene (Korea). 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) was obtained from amresco life science (USA). NO-Griess reagent A (1% sulfanilamide) and B (0.1% naphthylethylenediamine dihydrochloride) were purchased from Sigma-Aldrich. IL-1β/MCP-1 and IL-6/TNF-α ELISA kits for RAW264.7 cells were offered from R&D system (USA) and BD bioscience (USA), respectively. IL-1β, IL-6 and TNF-α ELISA kits for A549 cells were offered from BD bioscience.

Preparation of FM

The plant was collected from Ca Mau Province, Tran Van Thoi District, Tran Ho Community, Vietnam, in 2009. The plant samples were identified by Tran the Bach who is a taxonomist at the Institute of Ecology and Biological Resource (IEBR, Vietnam). A voucher specimen (KRIB0027903) was kept in the Korea Research Institute of Bioscience and Biotechnology (KRIBB, Korea) herbarium. The IBMRC at KRIBB offered the plant extract (FBM077-056). 110 g plant dried in shade and powdered was added to 1 L of HPLC grade MeOH (99.9%) and extracted through 30 cycles (40 KHz, 1500 W, 15 min, and 120 min standing per cycle) at room temperature (RT) using a SDN-900H ultrasonic extractor. After filtration (Qualitative Filter No.100, HYUNDAI MICRO Co., Ltd., Republic of Korea) and drying under reduced pressure, 2.42 g F. vasculosa extract was finally gained.

Cell culture

RAW264.7 cells (ATCC) have been moved on 96-well cell culture plate (per well, 2.5 × 104) in DMEM supplemented with 10% FBS. A549 airway epithelial cells (ATCC) were moved on 96-well cell culture plate at a density of 2.5 × 104 cells per well in RPMI 1640 supplemented with 10% FBS. To estimate cell viability, all cells were incubated with FM (5, 10 and 20 μg/ml) overnight and then MTT assay was then performed as previously described [8].

Experimental ALI animal models

Six-week-old male C57BL/6 mice (n = 30) were purchased from mouse manufacturing companies (Koatech Co., Pyeongtaek) and maintained in autoclaved cages of the SPF facility. For 3 days, the mice have been administered FM or dexamethasone (DEX), positive control (PC) via oral gavage (o.g.). A total of 1 h after the FM or DEX administration on day 3, the intranasal administration of 0.5 mg/kg LPS (40 μl per mouse) in the mice was performed to induce ALI. The experimental mice were grouped divided into 5 groups as follows: normal control group, LPS group (LPS only), DEX + LPS group (o.g. of 1 mg/kg DEX + LPS), FM 5 + LPS group (o.g. of 5 mg/kg FM + LPS) and FM 15 + LPS group (o.g. of 15 mg/kg FM + LPS). To analyze the levels of cytokines/chemokines and the histological changes, C57BL/6 mice have been anesthetized by the mixture of Zoletil/xylazine on day 5 and BAL fluid (BALF) collection was performed based on previous studies [8]. After the BAL fluid (BALF) collection, cervical dislocation was performed for sacrifice and lung tissue collection was performed for western blot sample preparations. The procedure of animal experimental was approved by IACUC of the KRIBB (Approval no. KRIBB-AEC-21111).

NO and ELISA

To perform the NO assay and ELISA, RAW264.7 cells were incubated in 96-well culture plate (per well, 2.5 × 104 cells) with FM (5, 10 and 20 μg/ml) for 60 min and stimulated with 500 ng/ml LPS for 20 h. Subsequently, NO assay was conducted to determine the levels of nitrogen monoxide in the cell culture supernatant and the absorbance was measured using an absorbance microplate reader (540 nm) [25]. To determine the levels of cytokines, A549 cells were incubated in 96-well culture plate (per well, 5 × 104 cells) with 5, 10 and 20 μg/ml FM for 60 min and then activated by 10 μg/ml LPS for overnight. ELISA for the measurement of cytokines (IL-1β, IL-6 and TNF-α) secretion in the cell culture media and in BALF of the mice with ALI was conducted using an absorbance microplate reader (450 nm).

Reverse transcription quantitative PCR (RT-qPCR)

TRIzol™ reagent was used for RNA isolation from RAW264.7 cells and the cDNA Synthesis kit was used for the synthesis of cDNA from RNA templates based on manufacturer's instructions. PCR amplification was conducted using forward and reverse primers (Table 1) as follows: An initial denaturation (94℃ for 5 min), annealing (60℃ for 30 sec), and extension (72℃ for 45 sec, 30 cycles). The final extension was carried out at 72℃ for 10 min. PCR was conducted using forward and reverse primers (Table 1).

Table 1 . Primer sequences used for RT-qPCR.

GeneForward primer sequences (5'→3')Reverse primer sequences (5'→3')
iNOSCAAGAGTTTGACCAGAGGACCTGGAACCACTCGTACTTGGGA
COX-2GAAGTCTTTGGTCTGGTGCCTGGTCTGCTGGTTTGGAATAGTTGC
HO-1TGAAGGAGGCCACCAAGGAGGAGAGGTCACCCAGGTAGCGGG
β-actinTGTTTGAGACCTTCAACACCCGCTCATTGCCGATAGTGAT


Extraction of nuclear and cytosolic fractions

The nuclear and cytosolic fraction was acquired based on a previous experimental procedure [7]. In brief, the cells were plated in a 60-mm cell culture plate (per well, 5 × 105 cells), incubated with FM for 60 min and activated by LPS for 30 min. The nuclear extraction kit was used for extraction of nuclear fractions.

Western blot analysis

The protein concentration in cell culture lysates was determined using a BCA assay. Proteins were separated by SDS-PAGE and transferred from the gel onto PVDF membranes. Then, membranes were maintained with blocking solution for 60 min and primary antibodies for 24 h. The information of primary antibodies is follows: iNOS (cat. no. 905-431, Enzo Life Sciences), COX-2 (sc-1747), p38 (sc-7149), β-actin (sc-69879), p65 (sc-8008) and PCNA (sc-56) (all from Santa Cruz Biotechnology, Inc., USA), phosphorylated (p)-JNK (cat. no. 4668), pp38 (9211), p-ERK (9101), JNK (9252), ERK (9102) and p65 (8242) (all from Cell Signaling Technology, Inc., USA), HO-1 (cat. no. 27338, Invitrogen; Thermo Fisher Scientific, Inc., USA) and Nrf2 (cat. no. 137550, Abcam). Each membrane was then rinsed in washing buffer (TBST), maintained with secondary antibodies and visualized using an ECL kit.

Immunocytochemistry

The preparation and procedure of immunocytochemistry was performed as described previously [7]. Briefly, RAW264.7 cells have been moved on chamber slides, fixed in paraformaldehyde solution 4%, permeabilized with 0.1% Triton X-100 and subsequently incubated with blocking buffer, 3% BSA. Next, cells were maintained with p65 antibody (4℃, 20 h), incubated with secondary antibody at RT (Alex Fluor™ 488 conjugated antibody) for 1 h and were maintained with DAPI at RT (5 min). Finally, the image of RAW264.7 cells were visualized using a confocal microscope.

Statistical analysis

Data are presented as mean ± standard deviation (SD). Statistical significance was determined using a two-tailed Student's t-test for comparisons between two groups. One-way analysis of variance (ANOVA) followed by a Dunnett's multiple comparison test was used to analyze differences between multiple groups. Data were analyzed using SPSS 20.0 (version 20.0; IBM Corp.). p < 0.05 was considered to indicate a statistically significant difference.

Results

Go to

Effect of FM on the reduction of the LPS-induced NO/PGE2 production and iNOS/COX-2 expression in RAW264.7 cells

The results of the MTT assay revealed that FM did not result in any noticeable cytotoxicity at 20 μg/ml in the RAW264.7 cells (Fig. 1A). Based on this result, 5, 10 and 20 μg/ml FM were used for subsequent studies. Administration of 0.5 μg/ml LPS led to a significant increase in NO and PGE2 generation in RAW264.7 cells (Figs. 1B and C). However, FM pre-treatment effectively reduced the LPS-induced NO and PGE2 generation. FM also exerted an inhibitory effect on the LPS-induced increase in iNOS and COX-2 expression (Figs. 1D−F). Furthermore, the notable upregulation in the mRNA expression of iNOS and COX2 in LPS-simulated RAW264.7 cells was decreased by FM pre-treatment (Figs. 1G−I).

Figure 1.FM downregulates the LPS-induced production of NO, PGE2, iNOS and COX-2 in RAW264.7 cells. (A) Cell viability was examined using MTT assay. The levels of (B) NO and (C) PGE2 were determined using an NO assay and PGE2 ELISA. (D) The expression levels of iNOS and COX-2 were detected using western blot analysis. The quantification of (E) iNOS and (F) COX-2 expression was conducted using densitometric analysis. (G) The mRNA expression levels of iNOS and COX-2 were detected using reverse transcriptionquantitative PCR. The quantification of (H) iNOS and (I) COX-2 mRNA expression was conducted using densitometric analysis. Data are expressed as the mean ± SD. # p < 0.05 compared to NC group; *p < 0.05 and ** p < 0.01 compared to the LPS group. FM, F. vasculosa methanol extract.

Effect of FM on the reduction of the LPS-Induced cytokine/ chemokine secretion in RAW264.7/A549 airway cells

To detect the secretion of molecules, ELISA was performed. The significant increase in IL-1β secretion was confirmed following exposure of the RAW264.7 cells to LPS, whereas this upregulation was considerably decreased by FM pre-treatment (Fig. 2A). Moreover, LPS exposure resulted in a notable increase in IL-6, TNF-α and MCP-1 secretion (Figs. 2B and C) in the RAW264.7 cells, while this increase was reduced by FM. Similar to the results presented in Fig. 1, 20 μg FM exerted notable inhibitory effects on the secretion of cytokines and chemokines. FM was pretreated to A549 airway epithelial cells to investigate its inhibitory ability on inflammatory cytokines. As shown in Figs. 2E−G, the pretreatment of FM reduced the production of inflammatory cytokines (IL-1β, IL-6 and TNF-α) in LPSstimulated A549 cells. In similar to those of MTT results in Fig. 1A, outstanding change of cell viability was not confirmed by FM in the A549 cells (Fig. 2H).

Figure 2.FM inhibits the LPS-induced increase in the levels of IL-1β, IL-6 and TNF-α in RAW264.7 cells and A549 cells. The levels of (A) IL-1β, (B) IL-6, (C) TNF-α and (D) MCP-1 in RAW264.7 macrophages were determined using ELISA. The levels of (E) IL-1β, (F) IL-6 and (G) TNF-α in A549 cells were determined using ELISA. (H) Cell viability of A549 cells was examined using MTT assay. Data are expressed as the mean ± SD. # p < 0.05 compared to the NC group; * p < 0.05 and ** p < 0.01 compared to the LPS group.

Effect of FM on the downregulation of the LPS-induced activation of MAPK in RAW264.7 cells

To determine the expression levels of MAPK activation, western blot (WB) analysis was performed. As shown in Fig. 3A, LPS exposure led to a marked upregulation in the levels of JNK, p38 and ERK phosphorylation (Figs. 3A and B). Of note, this tendency was ameliorated by FM pre-treatment. In particular, 20 μg FM exerted a significant inhibitory effect on LPSinduced JNK, p38 and ERK phosphorylation.

Figure 3.FM decreases the LPS-induced activation of MAPK in RAW264.7 cells. (A) The expression levels of JNK, p38 and ERK phosphorylation were detected using western blot analysis. (B) The quantification of p-JNK, p-p38 and p-ERK was performed using densitometry analysis. Data are expressed as the mean ± SD. # p < 0.05 compared to the NC group; * p < 0.05 and ** p < 0.01 compared to the LPS group.

Effect of FM on the suppression of the LPS-stimulated NF-κB nuclear translocation in RAW264.7 cells

We next examined the effect of FM on inhibition of NF-κB nuclear translocation. The results of immunocytochemistry revealed an increase in the intensity of NF-κB p65 in the nucleus, as shown in RAW264.7 macrophages exposed to LPS, while this was suppressed by FM (Fig. 4A). Moreover, the results of WB analysis revealed that p65 expression in the nuclei was notably upregulated by LPS exposure, whereas this increased expression was inhibited by FM pre-treatment (Figs. 4B and C).

Figure 4.FM suppresses the NF-κB nuclear translocation in LPS-stimulated RAW264.7 cells. (A) NF-κB nuclear translocation was detected using immunocytochemistry. Scale bar, 30 μm. (B) The expression levels of p65 in both the nucleus and cytosol were detected using western blot analysis. (C) The quantification of p65 was conducted using densitometry analysis. Data are expressed as the mean ± SD. # p < 0.05 compared to the NC group; * p < 0.05 and ** p < 0.01 compared to the LPS group. PCNA, proliferating cell nuclear antigen.

Effect of FM on HO-1 expression and Nrf2 nuclear translocation in RAW264.7 cells

Based on the importance of HO-1 induction in the amelioration of the inflammatory response [15], the present study examined whether FM administration could lead to HO-1 induction. The results confirmed that the levels of the protein/mRNA expression of HO-1 were significantly upregulated by FM in RAW264.7 cells (Figs. 5A and B). Furthermore, FM led to the Nrf2 nuclear translocation (Figs. 5C and D).

Figure 5.FM upregulates HO-1 expression and Nrf2 nuclear translocation in RAW264.7 cells. (A) The levels of HO-1 expression were determined using western blot analysis (B) The mRNA expression levels of HO-1 were determined using reverse transcriptionquantitative PCR. The quantification of protein/mRNA expression of HO-1 was conducted using densitometry analysis. (C) The expression levels of Nrf2 in both nucleus and cytosol were detected using western blot analysis. (D) The quantification of Nrf2 was conducted using densitometry analysis. Data are expressed as the mean ± SD. †p < 0.05 compared to the NC group.

Suppressive effect of FM on inflammatory molecules in mice with ALI

The results from the in vitro experiments revealed that FM exerted an anti-inflammatory effect in activated-RAW264.7 cells. Based on these effects, the present study examined whether FM exerts protective effects on airway inflammation in an experimental animal model of LPS-induced ALI. As shown in Fig. 6A−D, FM had reductive effect on the LPS-induced generation of cytokines and chemokines (IL-1β, IL-6, TNF-α and MCP-1) in the BALF of mice with ALI. Generally, 15 mg/ kg FM exerted a notable inhibitory effect.

Figure 6.FM inhibits the generation of cytokines and chemokines in mice with LPS-induced ALI. The levels of (A) IL-1β, (B) IL-6, (C) TNF-α and (D) MCP-1 in BALF of ALI mice were determined using ELISA. Data are expressed as the mean ± SD. # p < 0.05 compared to the NC group; * p < 0.05 compared to the LPS group. BALF, bronchoalveolar lavage fluid.

Discussion

Go to

This study confirmed the ameliorative property of FM on inflammation in RAW264.7 cells against LPSstimulation. In addition, its ameliorative effect on LPSstimulated inflammatory response was also confirmed in A549 airway cells. Generally, the inhibitory effects of 20 μg/ml FM on inflammatory molecules (mediators, cytokines and chemokines) were notable in the in vitro experiments. In addition, the suppressive effects of FM on LPS-induced IL-1β, IL-6, TNF-α and MCP-1 expression were notable in the in vivo experiments. Especially, the inhibitory properties of FM (15 mg/kg) on inflammatory molecules were generally similar to that of DEX. These results indicated that FM exerted a protective effect in both in vitro and in vivo experiments of endotoxininduced inflammation.

Considering that the MAPK/NF-κB signaling pathways have been admitted as an important target in ALI therapy [26, 27], the present study selected these signaling pathways to examine the underlying mechanisms. It was confirmed that FM could suppress the LPS-induced activation of JNK/p38/ERK in in vitro experiments. Similar to the results shown in of Figs. 1 and 2, which demonstrated the inhibitory effects of FM on inflammatory cytokines, chemokine and mediators, the inhibitory effect of 20 μg/ml FM on MAPK activation were notable. Furthermore, 20 μg/ml FM notably suppressed the NF-κB p65 nuclear translocation. Thus, these results suggest that FM may reduce the inflammatory response by regulating the MAPK and NF-κB signaling pathways.

It has been revealed that the activation of the Nrf2/ HO-1 pathway may contribute to the amelioration of the inflammatory response by reducing NF-κB activation [15, 16]. Thus, this study further examined if FM affects the Nrf2 nuclear translocation and HO-1 induction. As was expected, FM induced the nuclear translocation of Nrf2, as well as HO-1 induction. These results suggest that the effects of FM on HO-1 induction may affect the improvement of the inflammatory response by affecting NF-κB activation.

In conclusion, FM exerted anti-inflammatory effects in activated-macrophages and these effects were accompanied by the suppression of the MAPK and NF-κB signaling pathways. FM also had anti-inflammatory effects in activated-airway epithelial cells. In addition, FM led to the amelioration of airway inflammation in mice with ALI. These findings suggest that FM may exert protective effects in inflammatory lung diseases, suggesting that FM may prove to be a useful adjuvant or therapeutic agent in acute inflammatory diseases.

Acknowledgments

Go to

This research was supported by grants from KRIBB (Grant No. KGS123221), the Bio & Medical Technology Development Program of the National Research Foundation (NRF) and the Korean government (MSIT) (Grant. No. NRF-2020R1A2C2101228) of the Republic of Korea and the Vietnam Academy of Science and Technology, Project NVCC09.10/22-22.

Conflict of Interest

Go to

The authors have no financial conflicts of interest to declare.

References

Go to
  1. Huang X, Xiu H, Zhang S, Zhang G. 2018. The role of macrophages in the pathogenesis of ALI/ARDS. Mediators Inflamm. 2018: 1264913.
    Pubmed KoreaMed CrossRef
  2. Lee JW, Chun W, Lee HJ, Min JH, Kim SM, Seo JY, et al. 2021. The role of macrophages in the development of acute and chronic inflammatory lung diseases. Cells 10: 897.
    Pubmed KoreaMed CrossRef
  3. Eun SY, Seo J, Park SW, Lee JH, Chang KC, Kim HJ. 2014. LPS potentiates nucleotide-induced inflammatory gene expression in macrophages via the upregulation of P2Y2 receptor. Int. Immunopharmacol. 18: 270-276.
    Pubmed CrossRef
  4. Spadaro S, Park M, Turrini C, Tunstall T, Thwaites R, Mauri T, et al. 2019. Biomarkers for acute respiratory distress syndrome and prospects for personalised medicine. J. Inflamm. (Lond). 16: 1.
    Pubmed KoreaMed CrossRef
  5. Cao Z, Liu JL, Wu S, Wang Q. 2018. Mechanism of MCP-1 in acute lung injury and advanced therapy by drug-loaded dextrin nanoparticle. Int. J. Polym. Sci.. doi.org/10.1155/2018/9269154.
    CrossRef
  6. Min JH, Kim SM, Park JW, Kwon NH, Goo SH, Ngatinem, et al. 2021. Lagerstroemia ovalifolia exerts anti-inflammatory effects in mice of LPS induced ALI via downregulating of MAPK and NF-κB activation. J. Microbiol Biotechnol. 31: 1501-1507.
    Pubmed KoreaMed CrossRef
  7. Park JW, Ryu HW, Ahn HI, Min JH, Kim SM, Kim MG, et al. 2020. The Anti-inflammatory effect of Trichilia martiana C. DC. in the lipopolysaccharide-stimulated inflammatory response in macrophages and airway epithelial cells and in LPS-challenged mice. J. Microbiol. Biotechnol. 30: 1614-1625.
    Pubmed KoreaMed CrossRef
  8. Kim SM, Min JH, Kim JH, Choi J, Park JM, Lee J, et al. 2022. Methyl p-hydroxycinnamate exerts anti-inflammatory effects in mouse models of lipopolysaccharide-induced ARDS. Mol. Med. Rep. 25: 37.
    Pubmed KoreaMed CrossRef
  9. Xu B, Wang H, Chen Z. 2021. Puerarin inhibits ferroptosis and inflammation of lung injury caused by sepsis in LPS induced lung epithelial cells. Front. Pediatr. 4: 706327.
    CrossRef
  10. Lee JW, Park HA, Kwon OK, Park JW, Lee G, Lee HJ, et al. 2017. NPS 2143, a selective calcium-sensing receptor antagonist inhibits lipopolysaccharide-induced pulmonary inflammation. Mol. Immunol. 90: 150-157.
    Pubmed CrossRef
  11. Zhang C, Ning D, Pan J, Chen C, Gao C, Ding Z, et al. 2021. Anti-inflammatory effect fraction of Bletilla striata and its protective effect on LPS-induced acute lung injury. Mediators Inflamm. 2021: 6684120.
    Pubmed KoreaMed CrossRef
  12. Wu H, Yang Y, Guo S, Yang J, Jiang K, Zhao G, et al. 2017. Nuciferine ameliorates inflammatory responses by inhibiting the TLR4-mediated pathway in lipopolysaccharide-induced acute lung injury. Front. Pharmacol. 8: 939.
    Pubmed KoreaMed CrossRef
  13. Wang W, Yang QL, Shi YZ, Hou BY, Yang SQ, Huang H, et al. 2017. Protective effects of the ethanol extract of Viola tianshanica maxim against acute lung injury induced by lipopolysaccharides in mice. J. Microbiol. Biotechnol. 27: 1628-1638.
    Pubmed CrossRef
  14. Lee JW, Kim MO, Song YN, Min JH, Kim SM, et al. 2022. Compound K ameliorates airway inflammation and mucus secretion through the regulation of PKC signaling in vitro and in vivo. J. Ginseng Res. 46: 496-504.
    Pubmed KoreaMed CrossRef
  15. Ren J, Li L, Wang Y, Zhai J, Chen G, Hu K. 2019. Gambogic acid induces heme oxygenase-1 through Nrf2 signaling pathway and inhibits NF-κB and MAPK activation to reduce inflammation in LPS-activated RAW264.7 cells. Biomed. Pharmacother. 109: 555-562.
    Pubmed CrossRef
  16. Lee W, Lee CH, Lee J, Jeong Y, Park JH, Nam IJ, et al. 2021. Botanical formulation, TADIOS, alleviates lipopolysaccharide (LPS)-Induced acute lung injury in mice via modulation of the Nrf2-HO-1 signaling pathway. J. Ethnopharmacol. 270: 113795.
    Pubmed KoreaMed CrossRef
  17. Park JW, Oh JH, Hwang D, Kim SM, Min JH, Seo JY, et al. 2021. 3,4,5-Trihydroxycinnamic acid exerts anti-inflammatory effects on TNF-α/IFN-γ-stimulated HaCaT cells. Mol. Med. Rep. 24: 509.
    Pubmed KoreaMed CrossRef
  18. Kim YS, Hwang JW, Jang JH, Son S, Seo IB, Jeong JH, et al. 2016. Trapa japonica pericarp extract reduces LPS-induced inflammation in macrophages and acute lung injury in mice. Molecules 21: 392.
    Pubmed KoreaMed CrossRef
  19. Yuan J, Li X, Fang N, Li P, Zhang Z, Lin M, et al. 2022. Perilla Leaf Extract (PLE) attenuates COPD airway inflammation via the TLR4/Syk/PKC/NF-κB pathway in vivo and in vitro. Front. Pharmacol. 12: 763624.
    Pubmed KoreaMed CrossRef
  20. Kim SM, Ryu HW, Kwon OK, Hwang D, Kim MG, Min JH, et al. 2021. Callicarpa japonica Thunb. ameliorates allergic airway inflammation by suppressing NF-κB activation and upregulating HO-1 expression. J. Ethnopharmacol. 267: 113523.
    Pubmed CrossRef
  21. Chi VV. 2012. Dictionary of medicinal plants in Vietnam. Medical Publishing House, Hanoi 1: 849.
  22. National Institute of Medicinal Material. 2016. Checklist of medicinal plants in Vietnam. Science and Technology Publish House, pp. 332.
  23. Shi YX, Xu YK, Hu HB, Na Z, Wang WH. 2011. Preliminary assessment of antioxidant activity of young edible leaves of seven Ficus species in the ethnic diet in Xishuangbanna, Southwest China. Food Chem. 128: 889-894.
    CrossRef
  24. Bahri S, Ambarwati Y, Marlina L, Utami. 2020. Identification of phenyl propanoid compound isolated from root bark datuan (Ficus vasculosa Wall. Ex Miq) and antibacterial activity test on Escherichia coli. IOP Conf. Ser.: Earth. Environ. Sci. 537: 012046.
    CrossRef
  25. Lee JW, Ryu HW, Kim DY, Kwon OK, Jang HJ, Kwon HJ, et al. 2021. Biflavonoid-rich fraction from Daphne pseudomezereum var. koreana Hamaya exerts anti-inflammatory effect in an experimental animal model of allergic asthma. J. Ethnopharmacol. 265: 113386.
    Pubmed CrossRef
  26. Nie Y, Wang Z, Chai G, Xiong Y, Li B, Zhang H, et al. 2019. Dehydrocostus lactone suppresses LPS-induced acute lung injury and macrophage activation through NF-κB signaling pathway mediated by p38 MAPK and Akt. Molecules 24: 1510.
    Pubmed KoreaMed CrossRef
  27. Kim SM, Ryu HW, Kwon OK, Min JH, Park JM, Kim DY, et al. 2022. Protective effect of Paulownia tomentosa fruits in an experimental animal model of acute lung injury. Microbiol. Biotechnol. Lett. 50: 310-318.
    CrossRef

Article Tools

Starts of Metrics

Share this article on :

Related articles in MBL

Most Searched Keywords ?

What is Most Searched Keywords?

  • It is most registrated keyword in articles at this journal during for 2 years.