Contact us
닫기
Article Search
닫기

Microbiology and Biotechnology Letters

보문(Article)

View PDF

Food Microbiology (FM)  |  Probiotics in Nutrition and Health

Microbiol. Biotechnol. Lett. 2022; 50(3): 347-353

https://doi.org/10.48022/mbl.2206.06010

Received: June 27, 2022; Revised: July 8, 2022; Accepted: July 20, 2022

Synbiotics 첨가 사료 투여가 넙치(Paralichthys olivaceus)의 성장과 비특이적 면역 반응 및 세균성 감염 폐사에 미치는 영향

Effect of Synbiotics-Added Feeds on the Growth, Non-Specific Immune Response, and Disease Resistance of Olive Flounders, Paralichthys olivaceus

Chae-Yun Moon1, Hong-Ju Son2, and Moon-Soo Heo1*

1Department of Aquatic Life Medicine, Jeju National University, Jeju 63243, Republic of Korea
2Department of Life Science and Environmental Biochemistry, Pusan National University, Pusan 50463, Republic of Korea

Correspondence to :
MoonSoo Heo,       msheo@jejunu.ac.kr

Abstract

Go to

In this study, the effect of a synbiotic mixture of probiotics and 3% inulin on the growth, non-specific immune response, and mortality due to disease resistance of Paralichthys olivaceus was investigated. The results revealed that an 8-week diet of synbiotic-added feed, had no significant effect on the growth of P. olivaceus, Analysis of the hematological parameters revealed that there was a significant difference in the content of AST, total protein, and cholesterol among the groups, whereas there was no significant difference in the ALT and glucose contents. Further, there was no significant difference in the lysozyme activity of the synbiotic and control group after 8 weeks' feeding. In addition, when the symbiotic mixture was used rather than probiotics alone, the NBT activity of the synbiotic group increased compared to that of the control group. Moreover, when only probiotics were used, the cytokine expression in the spleen of the samples was significantly lower than that in the control group, whereas the expression was significantly higher in the spleen of the synbiotics group. However, there was no significant difference in the cytokine expression in the liver, intestine, and kidney of the three groups. Lastly, after injection for 2 weeks, the mortality rates of the control group towards Edwardsiella tarda, Streptococcus parauberis, and Streptococcus iniae were 95, 85 and 85%, respectively; those of the probiotics group were 85, 80, and 80%, respectively; and those of the synbiotics group were 80, 80, and 85%, respectively.

Keywords: Synbiotics, probiotics, prebiotics, Paralichthys olivaceus, non-specific immune, Bacillus cabrialesii

Graphical Abstract


서론

Go to

FAO에 따르면 양식업은 2018년 1억 1,450만 톤으로 사상최고치를 찍었고 연평균 5.3%로 지속적인 성장세를 보이고있다[1, 2]. 국내중 제주도는 가장 높은 어류 생산량을 보이고 있고 2020년 도내 어류양식현황에 따르면 넙치 물량이92.8%로 가장 큰 비중을 두고 있다.

이처럼 양식장에서는 생산되는 물량을 증대시키기 위한 고밀도 사육을 하거나 또는 오랫동안 운영되어온 양식장의 노후화된 시설 등과 같은 다양한 요인으로 질병 발생률이 증가될 수 있으며 심한 경우 대량 폐사로 이어질 수 있다[3].따라서 이러한 세균성질병을 치료하거나 예방하기 위해 혈청과 생백신 등[4−6]을 개발했음에도 불구하고 2015년 제주도의 양식장에서는 연쇄구균병(Streptococcusis) 9.76%, 비브리오병(Vibriosis), 1.35% 및 에드워드병(Edwardsiellosis) 0.55%의 폐사율이 보고되고 있으며[7], 2013년부터 2015년도까지 조사된 연구 결과에 따르면 연쇄구균병에 따른 경제적 피해가 지속적으로 발생되고 있었다[8].

최종적으로 효과적인 치료를 위해 양식장에서는 항생제를이용하게 되는데 이는 내성 균주의 발현을 증가시키고 이를 방지하기 위한 새로운 약제의 이용은 병원체 간의 내성 발생률만 증가시켜 악순환이 반복되고 있다[9]. 따라서 화학적요법의 대안으로 probiotics가 많이 연구되어 왔고 실제로 어류의 성장률[10] 및 생존 능력[11] 등과 같은 이로운 효과가입증되어왔다. 더 나아가 prebiotics와의 혼합을 통한synbiotics가 주목을 받았는데, 이는 pH 산도나 장내 환경에따라 생존하기 어려운 probiotics의 생존 능력을 강화하기 위한 prebiotics를 첨가제로 사용하게 되는데 이는 실제로 부착 능력과 성장을 자극시켜 장내 항상성과 건강함을 유지시켜준다고 알려져 있다[12].

본 연구에서는 기존에 연구된 probiotics인 Bacillus cabrialesii sp. K1과 inuline 3%을 이용하여 넙치의 성장과비특이적 면역반응 및 세균성 감염에 따른 폐사율을 확인하고자 한다. 이는 실제 양식 산업에서 겪고 있는 세균성 질병을 예방하기 위한 synbiotics의 이용 가능성에 관한 기초 자료로 사용될 것이라 사료된다.

재료 및 방법

Go to

실험어 준비

제주도 제주시 조천읍에 위치한 양식장에서 자치어 사이즈 넙치를 받아 조천읍 함덕리에 위치한 제주대학교 해양과학연구소에서 본 실험을 진행하였다. 실험어는 수조에 적응하도록 2주간 순치시켰고 넙치의 초기 평균 무게는9.9 ± 2.5 g, 평균 길이는 9.1 ± 0.5 cm로 1 ton 원형 수조에 각각 대조구, 단일 프로바이오틱스 및 신바이오틱스구를 70미씩 3반복으로 두었다. 해수의 상태는 수온 14.1−18.5℃, pH 7.22−8.09, 염분 30.74−31.72‰, DO 7.26−9.50로 유지되었고사료는 1일 2회 어체중의 2−3%씩 총 8주간 급이 하였다.

실험사료 제작

실험사료는 시판되고 있는 넙치 전용 배합사료(조단백질54%, 조지방 10%, 조섬유 3%, 조회분 15%, 칼슘 1.5%, 인2.7%, Suhyup Co., Korea)를 사용하였다. 프로바이오틱스와신바이오틱스는 이전 연구결과[13]에 따라 inuline 3%와 B. cabrialesii sp. K1을 혼합할 경우 Streptococcus parauberis에서 항균 능력이 증진됨에 따라 본 실험에 적용하여synbiotics로 사용되었다. 유산균은 3.4 × 108 CFU/ml-1의 농도로 맞추어 사용되었고 대조구를 제외한 나머지 사료는 37℃에서 48시간 건조시키고, 사용하기 전에는 4℃에 냉장하여보관하였다.

성장도 조사 및 혈액학적 분석

실험어의 무게와 길이 측정은 무작위로 5−10마리를 선발하고 평균을 내었고 혈액 채취를 위해 하루 전 절식시킨 후 100 ppm 농도의 2-phenoxyethanol (Sigma-Aldrich, USA)을 이용하여 마취시켜 진행되었다. 혈액학적 분석을 위해 각각의 수조의 넙치 5미를 무작위로 선별하고 미부에서 혈액을 채취하고 항응고제가 처리되지 않은 원심 분리 관에 넣은 후 5,000 ×g에서 10분간 원심분리 후 혈액생화학분석기(VetTest, Idexx Laboratories, USA)로 성분을 분석하였다.분석된 항목은 ALT (Alanine aminotransferase), AST (Aspartate aminotransferase), GLU (Glucose), CHOL (Cholesterol), TP (Total protein)가 조사되었다.

어류의 식세포의 활성산소 측정

혈청의 식세포 분석은 Anderson과 Siwicki (1995)에 따른실험방법[14]을 따라 분석되었다. 혈청 40 μl를 0.2% Nitroblue tetrazolium (NBT, Sigma-Aldrich)과 혼합한 뒤 상온에30분 반응시키고 1 ml dimethylformamide를 첨가하여 반응을 정지시켰다. 다음 2,000 ×g, 5분 원심분리한 후 상층액을 수거한 뒤 540 nm에서 Microplate reader Multiskan FC; Thermo scientific, USA)로 흡광도 값을 측정하였다.

Lysozyme 활성 테스트

혈청의 Lysozyme은 Ellis (1990)의 분석방법[15]에 따라진행되었다. 활성 테스트는 혈청 10 μl와 0.05 M sodium phosphate buffer (pH 6.2)로 혼합한 Micrococcus lysodeikticus (0.2 mg/ml) 190 ul를 96 well plate에 혼합시켰다. 다음 실온에서 Microplate reader를 이용하여 530 nm에서 30초와4분 30초에 흡광도를 측정하였고, 분당 0.001 min-1의 감소값을 나타낸 효소의 양으로 측정되었다.

Quantitative real-time PCR (qRT-PCR) 분석

넙치의 사이토카인이 발현 여부를 확인하기 위해quantitative real time-polymerase chain reaction (qRT-PCR)을 이용하였다. 실험은 넙치의 장기 조직인 간, 신장,비장, 장을 각각 분리하여 Hybrid-R™ kit (Geneall®, Korea)을 사용하였고 total RNA을 추출하였다. 다음 cDNA합성을 위해 ReverTra Ace-α-First strand cDNA synthesis kit (Toyobo, Japan)를 사용하고 난 후 30℃에서 10분, 42℃에서 20분 반응시킨 뒤 99℃, 5분 열처리하고 4℃에 보관하였다. 다음 qRT-PCR에서 유전자 발현을 확인하기 위해 각각의 샘플은 5 × HOT FIREPol EvaGreen Qpcr Supermix (ThermoFisher Scientific, USA) 4 ul, Forward primer와Reverse primer는 각각 0.5 ul, DEPC distilled water 14 ul, cDNA 1 ul 넣고 혼합하였다. 다음 CFX96™ Real-Time system (Bio-Rad; CFX 384)를 이용하여 initial denaturation 95℃에서 12분, 45 cycle 동안 95℃에서denaturation 10초, annealing 60℃, 15초 elongation 72℃에서 30초간 수행한 뒤 PCR 산물은 1.5% agarose gel에서 전기영동하여 확인하였다. 본 실험에 사용된 프라이머로 사용된sequence는 Table 1에 표기하였다.

Table 1 . Gene specific primers and gene bank accession number of Paralichthys olivaceus β-actin and immune related genes used in this study.

GeneSequence (5'-3')Base pair (bp)Accession No.
β-actinFCATCAGGGAGTGATGGTGGGTA107HQ386788.1
RATACCGTGCTCGATGGGGTACT
TNF-αFCAGCAGCGTCACTGCAGAGTTA120AB040448.1
RGTTACCACCTCACCCCACCATT
IL-1βFCATCACCACTGTCTGCTGGAAA122KF025662.1
RGCTACTCAACAACGCCACCTTG
IL-10FAGCGAACGATGACCTAGACACG114KF025662.1
RACCGTGCTCAGGTAGAAGTCCA


인위 감염에 따른 병 저항성

사료 내 단일 유산균 B. cabrialesii sp. K1과 prebiotics인inuline 3%를 혼합한 synbiotics의 첨가에 따른 어류 질병 세균에 대한 저항성에 미치는 영향을 확인하고자 S. iniae와 S. parauberis 그리고 E. tarda를 인위적으로 감염시켰다. 세균은 마리당 log10 6.0 CFU의 농도가 되도록 멸균된 생리식염수로 희석시킨 후 주사기를 이용하여 복강 내 주입하였다. 본실험은 8주간의 실험이 종료되는 대로 진행되었고 각 수조마다 무작위로 20미를 선정하여 2주 동안 제주대학교 해양과학대학 감염 실험용 수조 안에서 진행되었고 아래와 같은식을 적용하여 생존율을 측정하였다.

Relative percentage of survival (RPS) = 100 − 100 × (test mortality/control mortality).

통계 분석

모든 실험의 분석은 SPSS (IBM®, USA) program을 이용하여 통계 처리하였다. 일원배치 분산분석(One-way ANOVA-test)로 통계 분석을 진행하고 Tukey test t-test (p < 0.05)를이용하여 대조구, probiotics구, synbiotics구의 평균을 비교하였다. 모든 데이터는 평균값 ± 표준편차(mean ± SD)로 표기하였다.

결과 및 고찰

Go to

성장도 조사 및 혈액학적 결과

일반적으로 어류 유산균 사료 첨가제로 많이 연구된 Lactobacillus plantarum이나 Bacillus subtilis의 경우 일반 사료를 첨가한 대조군보다 유의적으로 높았음이 시사되었다[16]. 반면에 본 연구에서 사용된 프로바이오틱스 B. cabrialesii sp. K1과 inulin 3%와 혼합된 신바이오틱스를 첨가하여 8주동안 급이 후 성장 매개변수를 확인한 결과 Table 2와 같이 대조구와 비교 시 전반적으로 유의적인 차이는 없었다. 혈액학적 검사 결과에서는 간의 건강 지표 중 하나인ALT와 에너지 소비 증가를 확인할 수 있는 지표인 Glucose [17]의 경우 유의적 차이가 없었으나 AST, TP 및 CHO의 결과 값에서는 유의적인 차이를 보였다(Table 3). ALT와 AST의 값은 간과 비장에 존재하는데 수치가 높을수록 동물의 건강 악화 및 조직 괴사가 발생 시 증가될 수 있다[18]. Probiotics구는 대조군과 Synbiotics구보다 낮은 AST 값을 나타내어 두 개의 구보다 건강함을 나타내었다. Total protein (TP) 결과 대조구와 비교 시 probiotics와 synbiotics가 높은 유의적 차이를 나타냈는데, 이는 먹이 급여 여부에따라 결과값이 상이할 수 있으며[19], 유산균을 첨가할 경우간장에서 단백질을 합성하거나 분비를 촉진하는 작용 등에의해 혈중 내 단백질량이 증가될 수 있음을 시사했으며[20]본 연구 역시 동일한 결과값을 나타내었다. Cholesterol (CHO)은 스테로이드 호르몬의 전구체 역할과 세포막 구조에도 관여하며 독성 여부에 따라 산화 스트레스가 발생되며콜레스테롤혈증이 유발된다고 알려져 있다[21]. 본 연구에서는 대조구에 비해 probiotics와 synbiotics구가 유의적으로 낮아진 것을 확인했고 그 중 probiotics가 매우 낮게 측정되었다. 이러한 결과는 유산균이 장 안의 콜레스테롤의 동화[22],제거, 흡수[23] 등에 따른 것으로 추정된다. 결과적으로 대조구에 비해 probiotics구와 synbiotics구가 유의적으로 혈장 내AST, TP 및 CHO 값이 낮게 측정되어 유산균 첨가에 따른현상으로 사료된다.

Table 2 . Antibacterial activity of LAB isolated from Korean traditional food.

IW1FW2WG3SGR4FCR5
Control12.8 ± 2.325.6 ± 6.0107.8 ± 67.53.7 ± 1.92.2 ± 1.4
Probiotics12.6 ± 1.826.8 ± 4.4115.2 ± 41.44.1 ± 1.01.5 ± 0.3
Synbiotics10.8 ± 0.826.6 ± 4.3146.5 ± 38.14.8 ± 0.81.3 ± 0.4

1, initial weight (g/fish)

2, final weight (g/fish)

3, weight gain (%) = (final weight-initial weight)/initial weight × 100

4, Specific growth rate (%) = [(final body weight-initial body weight)/time(days) × 100

5, Feed conversion ratio (%) consumed/weight gain

Table 3 . Serum biochemical parameters of Paralichthys olivaceus fed with control, probiotics and synbiotics diets for 8 weeks.

ALT (U/L)AST (U/L)GLU (mg/dl)TP (g/dl)CHO (mg/dl)
Control24.3 ± 3.520 ± 1.714.7 ± 2.32.5 ± 0.3189.7 ± 2.5
Probiotics24.3 ± 3.211 ± 1.014.7 ± .63.4 ± 0.2122.0 ± 1.0
Synbiotics19.0 ± 2.620 ± 2.015.0 ± 1.73.7 ± 0.3160 ± 2


Lysozyme 활성 및 식세포의 활성산소 결과

Lysozyme 활성은 그람 양성균을 용해하고 음성은 직접적으로 용균 작용을 하며 보체와 항체의 도움으로 용균 반응이 증강된다고 알려져 있다[24]. 또한 비특이적 면역 반응 요소 중 하나로 유산균 첨가 또는 주사제로 인한 라이소자임활성에 유익[25]한 반면, 본 연구에서는 8주동안 대조구와 비교 시 유의적 차이가 없었다(Fig. 1). Nitroblue tetrazolium (NBT) 활성의 결과는 호중구와 대식세포와 같은 식세포가세포 내의 산화 반응에 따라 청색 물질로 환원되는 것을 지표로 본 연구에서는 8주차에 대조구에 비해 synbiotics구가유의적으로 향상되었다(Fig. 2). 이처럼 유산균을 혼합한 경우 틸라피아는 15일째[26], 무지개 송어는 4주 후 NBT 감소가 약간 증가됨을 시사했고[27], 넙치에서는 4주부터 증가[28]되었으나 본 연구에 사용된 Bacillus cabrialesii sp. K1의 경우 8주차에 단일 사용보다 prebiotics와의 혼합 시 대조군에 비해 Nitroblue tetrazolium (NBT) 활성이 증가된것을 확인할 수 있었다.

Figure 1.Lysozyme activity in the serum from the paralichthys olivaceus fed with commercial diet, probiotics and sybiotics diet.

Figure 2.NBT activity of Paralichthys olivaceus fed with control, probiotics and synbiotics diets for 8 weeks.

Quantitative real-time PCR (qRT-PCR) 분석 결과

대식세포에서 분비되는 TNF-α는 사이토카인 발현 cascade초기 단계에 관여[29]하며 혈액 내 단핵구와 호중구의 비율이 증가하여 유산균을 섭취 시 어류의 선천적인 면역이 증가[30]된다고 알려져 있다. 본 연구에 사용된 Bacillus cabrialesii sp. K1를 단일(probiotics구)로 사용했을 경우 대조구와 비교 시 비장에서 유의적으로 낮게 발현되었으나synbiotics구의 경우 비장에서 발현이 유의하게 증가되었다.그러나 나머지 간과 장, 신장에서는 세 개의 그룹 간의 유의적 차이를 나타내지 않았다(Fig. 3). IL-1β는 자가로 염증 조절을 하는데 이는 대식세포나 NK 세포, 림프구를 자극해 체내로 들어온 병원균을 사멸시키는 핵심적인 반응매개체[31]로 장에서는 sybiotics구가 유의적으로 높게 발현되었으나 나머지 기관에서는 대조구만 발현되는 것으로 확인되었다. IL-6의 발현은 대사를 관장하고 뼈를 형성하는데 도움이 되는유전자[32]로 probiotics구는 신장을 제외하고 모든 대조구에 비해 유의하게 높았고, synbiotics구는 간과 신장을 제외하고 유의하게 발현되는 것을 확인할 수 있었다. IL-10은 항염증 유전자의 대표로 면역을 조절하는 기전을 규명하는데유전자로 많이 연구[33]되고 있으며, synbiotics구에서 유의하게 높게 발현되는 것이 확인되었다. 이는 기존의 대조구나probiotics에 비해 더 나은 면역 균형을 갖고 있다고 알 수 있다. 그럼에도 불구하고 면역 관련 유전자 발현에 관한 메커니즘에 관한 이해는 아직까지도 낮은 편에 속해 이를 향상시키기 위해 지속적인 연구가 필요하다 사료된다.

Figure 3.Immune related gene expression in each tissue such as kidney, intestine, spleen and liver after 8 weeks fed with control, probiotics and synbiotics diets.

인위 감염에 따른 병 저항성 결과

2주간의 인위 감염을 검토해본 결과, 대조구는 E. tarda 95%, S. parauberis 85%, S. iniae 85%로 각각의 폐사율을나타냈다. Probiotics구는 E. tarda 85%, S. parauberis 80%, S. iniae 80%의 폐사율을 보였고, synbiotics구는 E. tarda 80%, S. parauberis 80%, S. iniae 85%로 각각 나타내었다(Fig. 4). Bacillus 종에 관한 이전 연구에 따르면 S. iniae에인위적으로 감염시킨 결과 본 연구와 유사하게 생존율이 조금 높아지긴 했으나 유의하게 증가되지 않음을 시사했다[34].다른 한편으론 Lactococcus lactis를 이용하여 S. iniae에 관한 병 저항성이 상당히 크게 작용하여 생존율을 높이는 보고도 있었다[35]. 본 연구에서는 상당한 효과를 얻지 못했으나 Bacillus cabrialesii에 관한 연구결과가 없으므로 추후 기초자료로 사용될 것을 기대한다.

Figure 4.Cumulative mortality rate of paralichthys olivaceus after challenge with E. tarda, S. iniae and S. parauberis (log10 6.0 CFU).

요약

Go to

본 연구는 기존의 probiotics로서의 안전성을 입증한 B. cabrialesii sp. K1과 prebiotics 중 inulin 3%와 혼합하여synbiotics로서의 넙치의 성장과 비특이적 면역 반응 및 세균성 감염에 따른 폐사에 미치는 영향을 검토하였다. 8주 동안 단일 프로바이오틱스 B. cabrialesii sp. K1과 inulin 3%를 혼합한 신바이오틱스를 급이 한 결과 성장에서는 유의적인 차이를 보이지 않았다. 혈액학적 검사의 경우 AST, total protein 및 cholesterol에서 유의적인 차이를 보였고 ALT와glucose는 유의적인 차이가 없었다. 비특이적 면역반응에서는 유산균 첨가 또는 주사제로 인한 라이소자임 활성이 유익하다고 알려져 있으나 본 연구에서는 8주동안 대조구와 비교시 유의적 차이가 없었다. 또한 B. cabrialesii K1의 경우 단일 프로바이오틱스구보다 신바이오틱스구가 대조구에 비해NBT 활성이 증가된 것을 확인할 수 있었다. 다음 넙치의 사이토카인 발현을 확인한 결과 B. cabrialesii sp. K1를 단일(probiotics구)로 사용했을 경우 대조구와 비교 시 비장에서유의적으로 낮게 발현되었으나 synbiotics구의 경우 비장에서 발현이 유의하게 증가되었다. 그러나 나머지 간과 장, 신장에서는 세 개의 그룹 간의 유의적 차이를 나타내지 않았다. 마지막으로 2주동안의 인위 감염을 검토한 결과 대조구는 E. tarda 95%, S. parauberis 85%, S. iniae 85%로 각각의 폐사율을 나타냈다. Probiotics구는 E. tarda 85%, S. parauberis 80%, S. iniae 80%의 폐사율을 보였고, synbiotics구는 E. tarda 80%, S. parauberis 80%, S. iniae 85%로 각각 나타났다.

Acknowledgment

Go to

This work was supported by the research grant of Jeju National University in 2022.

Conflict of Interest

Go to

The authors have no financial conflicts of interest to declare.

References

Go to
  1. FAO. 2020. The state of world fisheries and aquaculture 2020. Sustainability in action. Rome. https://doi.org/10.4060/ca9229en
  2. FAO. 2021. 2021 COFI declaration for sustainable fisheries and aquaculture. Rome. http://doi.org/10/4060/cb3767en
  3. Cho MY, Kim MS, Kwon MG, Jee BY, Choi HS, Choi DL, et al. 2007. Epidemiological study of bacterial diseases of cultured olive flounder, Paralichthys olivaceus from 2005 to 2006 in Korea. J. Fish Pathol. 20: 61-70.
  4. Takano T, Matsuyama T, Oseko N, Sakai T, Kamaishi T, Nakayasu C, et al. 2010. The efficacy of five avirulent Edwardsiella tarda strains in a live vaccine against Edwardsiellosis in Japanese flounder, Paralichthys olivaceus. Fish Shellfish Immunol. 29: 687-693.
    Pubmed CrossRef
  5. Liu F, Tang X, Sheng X, Xing J, Zhan W. 2017. Comparative study of the vaccine potential of six outer membrane proteins of Edwardsiella tarda and the immune responses of flounder (Paralichthys olivaceus) after vaccination. Vet. Immunol. Immunopathol. 185: 38-47.
    Pubmed CrossRef
  6. Li J, Mo Z, Li G, Xiao P, Huang J. 2015. Generation and evaluation of virulence attenuated mutants of Edwardsiella tarda as vaccine candidates to combat edwardsiellosis in flounder (Paralichthys olivacues). Fish Shellfish Immunol. 43: 175-180.
    Pubmed CrossRef
  7. Shim JD, Hwang SD, Jang SY, Kim TW, Jeong JM. 2019. Monitoring of the mortalities in oliver flounder (Paralichthys olivaceus) farms of Korea. J. Fish Pathol. 32: 29-35.
  8. Kim KW, Yoo EH, Yang HY, Kang BJ. 2020. Isolation characteristics of causative agent of streptococcosis and serotype changes of Streptococcus parauberis from olive flounder (Paralichthys olivaceus) in Jeju. J. Fish Pathol. 33: 119-125.
  9. Inglis V. 1996. Proceedings of the meeting on the use of chemicals in aquaculture in Asia 20-22 May 1996, tigbauan, lloilo, philippines. pp. 7-22.
  10. Jang IS, Kim DH, Heo MS. 2013. Dietary administration of probiotics, Bacillus sp. IS-2, enhance the innate immune response and disease resistance of Paralichthys olivaceus against streptococcus iniae. Korean J. Microbiol. 49: 172-178.
    CrossRef
  11. Kim J, Lee KW, Jeong HS, Ansary WR, Kim HS, Kim T, et al. 2019. Oral administration effect of yacon, ginger and blueberry on the growth, body composition and plasma chemistry of juvenile olive flounder (Paralichthys olivaceus) and immunity test against Streptococcus iniae compared to a commercial probiotc, Lactobacillus fermentum. Aquac. Rep. 15: 100-212.
    CrossRef
  12. Pandy KR, Naik SR, Vakil BV. 2015. Probiotics, prebiotics and synbiotics-a review. J. Food Sci. Technol. 52: 7577-7587.
    Pubmed KoreaMed CrossRef
  13. Moon CY, Heo MS. 2021. Characteristics of probiotics isolated from korean traditional foods and antibacterial activity of synbiotics. Microbiol. Biotechnol. Lett. 49: 552-558.
    CrossRef
  14. Anderson DP, Siwicki AK. 1994. Duration of protection against Aeromonas salmonicida in brook trout immunostimulated with glucan or chitosan by injection or immersion. Progressive Fish-Culturist 56: 258-261.
    CrossRef
  15. Ellis AE. 1990. Lysozyme assay. In Stolen JS, Fletcher TC, Anderson DP, Roberson BS, van Muiswinkel WB (eds.), Techniques in Fish Immunology. pp. 101-103. Fair Haven, (USA), SOS publications.
  16. Li Y, Yang Y, Song L, Wang J, Hu Y, Yang Q, et al. 2021. Effects of dietary supplementation of Lactobacillus plantarum and Bacillus subtilis on growth performance, survival, immune response, antioxidant capacity and digestive enzyme activity in olive flounder. Aquac. Fish. 6: 283-288.
    CrossRef
  17. Alvarellos SS, Arjona FJ, Rio MPM, Miguez JM, Mancera JM, Soengas JL. 2005. Time course of osmoregulatory and metabolic changes during osmotic acclimation in Sparus auratus. J. Exp. Biol. 208: 4291-4304.
    Pubmed CrossRef
  18. Park IS, Hur JW, Choi JW. 2012. Hematological responses, survival, and respiratory exchange in the olive flounder, paralichthys olivaceus, during starvation. Asian-Aust. J. Anim. Sci. 25: 1276-1284.
    Pubmed KoreaMed CrossRef
  19. Cho SH. 2009. Effect of facsting and refeeding on growth and blood chemistry in juvenile olive flounder paralichthys olivaceus L. J. Aquaculture 22: 11-15.
  20. Park SH, Wang SY, Han KN. 2008. Effects of dietary supplement of probiotics on growth and blood assay of Rockfish Sebastres schlegeli. J. Aquac. 21: 1-6.
  21. Khaled HB, Ghlissi Z, Chtourou Y, Hakim A, Ktari N, Fatma MA, et al. 2012. Effect of protein hydrolysates from sardinelle (Sardinella aurita) on the oxidative status and blood lipid profile of cholesterol-fed rats. Food Res. Int. 45: 60-68.
    CrossRef
  22. Walker DK, Gilliland SE. 1993. Relationships among bile tolerance, bile salt deconjugation, and assimilataion of cholesterol by lactobacillus acidophilus. J. Dairy Sci. 76: 956-961.
    CrossRef
  23. Klaver FAM, Meer R. 1993. The assumed assimilation of cholesterol by Lactobacilli and Bifidobacterium bifidum is due to their bile salt-deconjugationg activity. Appl. Environ. Microbiol. 59: 1120-1124.
    Pubmed KoreaMed CrossRef
  24. Jung SH, Lee JS, Han HK, Jun CY, Lee HY. 2002. Effects of medicinal herb extract on non-specific immune responses, hematology and disease resistance on Olive flounder, Paralichthys olivaceus by oral administration. J. Fish Pathol. 15: 25-35.
  25. Kim YR, Kim EY, Choi SY, Hossain MT, Oh R, Heo WS, et al. 2012. Effect of a probiotic strain, Enterococcus faecium, on the immune responses of olive flounder (Paralichthys olivaceus). J. Microbiol. Biotechnol. 22: 526-529.
    Pubmed CrossRef
  26. Taoka Y, Maeda H, Jo JY, Kim SM, Park SI, Yoshikawa Y, et al. 2006. Use of live and dead probiotic cells in tilapia Oreochromis niloticus. Fish. Sci. 72: 755-766.
    CrossRef
  27. Sharifuzzaman SM, Austin B. 2009. Influence of probiotic feeding duration on disease resistance and immune parameters in rainbow trout. Fish Shellfish Immunol. 27: 440-445.
    Pubmed CrossRef
  28. Harikrishnan R, Kim MC, Kim JS, Balasundaram C, Heo MS. 2011. Immunomodulatory effect of probiotics enriched diets on Uronema marinum infected live flounder. Fish Shellifh Immunol. 30: 964-971.
    Pubmed CrossRef
  29. Sorimachi K, Akimoto K, Hattori Y, Ieiri T, Niwa A. 1999. Secretion of TNF-α, IL-8 and nitric oxide by macrophages activated with polyanions, and involvement of interferon-γ in the regulation of cytokine secretion. Cell Struct. Funct. 26: 103-108.
    Pubmed CrossRef
  30. Standen BT, Rawling MD, Davies SJ, Castex M, Foey A, Gioacchini G, et al. 2013. Probiotic Pediococcus acidilactici modulates both localized intestinal-and peripheral-immunity in tilapia (Oreochromis niloticus). Fish Shellfish Immunol. 35: 1097-1104.
    Pubmed CrossRef
  31. Alejo A, Tafalla C. 2011. Chemokines in teleost fish species. Dev. Comp. Immunol. 35: 1215-1222.
    Pubmed CrossRef
  32. Scheller J, Chalaris A, Dirk SA, Stefan RJ. 2011. The pro- and antiinflammatory properties of the cytokine interleukin-6. Biochim. Biophys. Acto - Mol. Cell Res. 1813: 878-888.
    Pubmed CrossRef
  33. Jang WJ, Hasan MT, Lee BJ, Hur SW, Lee S, Kim KW, et al. 2020. Effect of dietary differences on changes of intestinal microbiota and immune-related gene expression in juvenile olive flounder (Paralichthys olivaceus). Aquaculture 527: 735442.
    CrossRef
  34. Cha JH, Rahimnejad S, Yang SY, Kim KW, Lee KJ. 2013. Evaluations of Bacillus spp. As dietary additives on growth performance, innate immunity and disease resistance of live flounder (Paralichthys olivaceus) against Streptococcus iniae and as water additives. Aquaculture 402-403: 50-57.
    CrossRef
  35. Kim D, Beck BR, Heo SB, Kim J, Kim HD, Lee SM, et al. 2013. Lactococcus lactis BFE920 activates the innate immune system of olive flounder (Paralichthys olivaceus), resulting in protection against Streptococcus iniae infection and enhancing feed efficiency and weight gain in large-scale field studies. Fish Shellifh Immunol. 35: 1585-1590.
    Pubmed CrossRef

Article Tools

Starts of Metrics

Share this article on :

Related articles in MBL

Most Searched Keywords ?

What is Most Searched Keywords?

  • It is most registrated keyword in articles at this journal during for 2 years.