Contact us
닫기
Article Search
닫기

Microbiology and Biotechnology Letters

Research Article(보문)

View PDF

Fermentation Microbiology (FM)  |  Fermentation Technology

Microbiol. Biotechnol. Lett. 2024; 52(3): 298-303

https://doi.org/10.48022/mbl.2405.05002

Received: May 3, 2024; Revised: June 27, 2024; Accepted: July 8, 2024

유산균을 활용한 미역발효추출물이 3T3-L1에서 지방세포 분화에 미치는 영향

Effects of Undaria pinnatifida and Leuconostoc mesenteroides Fermented Extracts on Adipocyte Differentiation in 3T3-L1 Cells

Min Woo Moon and Chae Hun Ra*

Department of Food Science and Biotechnology, College of Engineering, Global K-Food Research Center, Hankyong National University, Anseong 17579, Republic of Korea

Correspondence to :
Chae Hun Ra       chra@hknu.ac.kr

Abstract

Go to

This study aimed to examine the potential inhibitory effect of Undaria pinnatfida fermented by Leuconostoc mesenteroides (UFM) on preadipocyte differentiation in the 3T3-L1 cell line. Ethanol extracts from UFM were prepared and tested for cell viability, Oil Red O staining, and quantitative reverse transcription-PCR (RT-qPCR) in 3T3-L1 adipocytes. Treatment of preadipocytes with UFM at different concentrations (50, 100, and 200 μg/ml) found that it inhibited lipid accumulation by 66.80%, 61.59%, and 55.94%, respectively. Furthermore, RT-qPCR showed that UFM extract reduced the gene expressions of CCAAT/enhancer-binding protein α (C/EBP α), peroxisome proliferator-activated receptor γ (PPAR γ), adipocyte-specific lipid binding protein (aP2), fatty acid synthase (FAS), and ATP citrate lyase (ACL), respectively. These results suggest that UFM can be a beneficial functional ingredient to prevent obesity in the food industry.

Keywords: Obesity, adipogenesis, Undaria pinnatifida, fermentation, Leuconostoc mesenteroides

Graphical Abstract


서론

Go to

현대사회는 식생활이 서구화됨에 따라 고칼로리 음식의 섭취 및 운동 부족으로 비만 인구가 증가하고 있다. 체내에 지방이 많을수록 고지혈증, 동맥경화 및 고혈압 등의 여러 심혈관질환과 당뇨와 같은 비만대사 관련 질환들을 유발한다.[1]. 지방세포(adipocytes)는 에너지 항상성 유지 및 지질대사에 중요한 역할을 한다. 3T3-L1 전지방세포(preadipocyte)는 분화배지에 의해 지방세포(adipocytes)로의 분화가 가능하고 세포의 형태학적 변화, 호르몬 반응 및 지방대사와 관련된 유전자들의 발현 등 다양한 in vitro 연구에 사용되고 있다[2]. 대표적인 지방 분화에 관여하는 전사인자(transcription factor)에는 분화 초기단계의 CCAAT/enhancer-binding protein (C/EBP)와 후기분화에 관여하는 peroxisome proliferator-activated receptor γ (PPAR γ)가 분화과정을완성하는데 관여한다[3]. 이들은 adipose-specific 유전자인sterol response element binding protein (SREBP), lipoprotein lipase (LPL), adipocyte-specific lipid binding protein (aP2), fatty acid synthase (FAS), 그리고 ATP citrate lyase (ACL) 등의 유전자 발현을 활성화함으로서 분화된 세포 내 지방을 축적하는 생화학적 특징을 가진다[4].

미역(Undaria pinnatifida)은 다시마목 미역과 갈조류이며, 알긴산(alginic acid), 라미나린(laminarin) 등과 같은 다당류와 폴리페놀 등이 풍부하며 항염, 항비만 효능이 있다고보고되고 있다[5−7]. 해조류의 전처리 방법에는 물리적, 화학적, 효소당화 방법이 있다. 본 연구에서는 비용이 비교적저렴하고 효율적인 방법인 산촉매 열가수분해(thermal acid hydrolysis) 전처리를 사용하였다[8, 9].

유산균은 다양한 대사산물을 생성하는 probiotics로서 소화 및 흡수에 도움을 주고, 장내부패 억제, 설사 및 변비의 개선, 장내 유해균의 억제 등 다양한 효능이 있으며[10], 최근 연구에는 Leuconostoc mesenteroides 유산균이 지방분화억제 효과가 있는 것으로 보고되고 있다[11]. 따라서 본 연구는 유산균의 미역발효 추출물(U. pinnatfida fermented by L. mesenteroides, UFM)이 3T3-L1 지방세포 분화에 미치는 영향에 대해 연구를 수행하였다.

재료 및 방법

Go to

실험재료 및 추출물 제조

본 연구에서 사용된 해조류 미역(U. pinnatifida)은 부산의 기업인 ㈜기장사람들에서 상품으로 가공하고 남은 건조부산물을 구매하여 분쇄기로 갈아서 입자 크기가 200 μm이하의 미역을 사용하였다. 실험에 사용된 유산균 L. mesenteroides SGL152는 한국프로바이오틱스은행(Korean Culture Collection of Probiotics, Korea)에서 분양을 받았으며, 유산균을 이용한 미역발효는 선행연구 Kim [12]의 전처리, 효소당화 및 발효조건과 동일하게 수행하였다. 산촉매열가수분해 전처리 조건은 8% (w/v) 슬러리 농도, 180 mM황산, 그리고 121℃, 30분동안 처리하였으며, 실온에서 냉각후 pH 5.0로 중화한 뒤 8 U/ml의 Celluclast 1.5 L를 첨가하여 45℃, 24시간 동안 효소당화를 진행하였다. 이러한 미역가수분해 배지에 2.0 g/l yeast extract, 5 g/l K2HPO4, 0.25 g/l MgSO4, 30 μM PLP, 30 g/l MSG를 따로 멸균하여배지에 첨가하였다. 이후 유산균 L. mesenteroides SGL152를 5% 접종한 후 30℃, 120 rpm, 96 h 동안 발효를 진행하였다.

에탄올 추출물 제조는 3 g 발효추출물 파우더/80% 에탄올100 ml 혼탁액을 60℃에서 2시간 동안 환류 추출한 뒤, 추출용액은 필터 종이(8 μm; Whatman, UK)에 여과하였다. 감압 추출 농축장치(EYELA N-1000, Riakikai Co., Ltd., Japan)로 농축한 뒤 50 mM potassium phosphate buffer (pH 6.8) 30 ml에 용해시켜 시료를 준비하였다.

3T3-L1 세포 배양 및 분화 유도

본 연구에 사용한 3T3-L1은 한국세포주은행(KCLB, Republic of Korea)에서 분양받았다. 세포 배양 환경은 37℃, 5% CO2로 조절한 CO2 인큐베이터(BH-120CA/B; Neuronfit Co, Ltd., Republic of Korea)에서 배양하였다. 2일마다 10%Bovine Calf Serum (BCS, WELGENE)이 첨가된 DMEM (Dulbecco’s Modified Eagle’s Medium, WELGENE) 배지로 교체해주고, 세포가 70−80% 밀도가 되었을 때 계대 배양하였다. 지방세포로 분화 유도하기 위해 12-well cell culture plate에 1×105 cells/well 농도로 분주하고 세포가 confluent할 때까지 배양한 뒤, 10% fetal bovine serum (FBS, WELGENE), 1 μM Dexamethasone (DEX, Sigma-Aldrich Co., USA), 0.5 mM 3-isobutyl-1-methlyxanthine (IBMX, Sigma-Aldrich Co.), 10 μg/ml의 insulin (Sigma-Aldrich Co.)이 첨가된 MDI 배지로 배양하였다. 10% FBS, 10 μg/ml insulin를 2일 간격으로 배지에 첨가한 후 8일차까지 배양하였다. 추출물은 농도별로 MDI 배지로 교체할 때 같이 처리하였다.

세포 독성 평가

세포 독성 평가는 Sim [13]의 방법을 참고하여 진행하였다. 3T3-L1 지방전구세포는 96-well plate에 녹여 1 × 104 cells/100 μl의 밀도로 분주 후 24시간 배양하였다. DMEM배지 90 μl에 25, 50, 100, 200 μg/ml의 농도로 희석한 유산균의 미역발효 추출물(UFM)을 각각 10 μl, 대조군 control은 50 mM potassium phosphate buffer (pH 6.8) 10 μl를첨가하여 100 μl로 맞춘 후 24시간 동안 배양하였다. 그 후5 mg/ml의 MTT 용액 20 μl를 첨가하여 빛을 차단한 상태로2시간 동안 배양하였다. 반응에 의해 생성된 formazan에DMSO 200 μl를 첨가하여 microplate reader (Multiskan FC, Thermo Fisher Scientific, USA)의 파장을 570 nm로설정 후 흡광도를 측정하여 다음 식 (1)로 상대적인 세포 생존율을 계산하였다.

Cell viability (%) =Absorbance of sample-Absorbance of blankAbsorbance of control-Absorbance of blank×100

Oil red O 염색

Oil red O 염색은 Gu [14]를 참고하여 진행하였다. 3T3-L1 지방세포의 지방분화 및 축적에 미치는 영향을 평가하기위해 유산균의 미역발효 추출물(UFM)을 25, 50, 100, 200 μg/ml의 농도로 각 well에 처리한 다음 분화된 3T3-L1지방세포에 1X PBS(pH 7.4)로 세척하여 4% formalin으로1시간 고정시켰다. 60% isopropanol로 세척 후 Oil red O strained solution 400 μg/ml를 첨가하여 20분간 상온에서염색을 진행하였다. 증류수로 2회 세척 뒤, 현미경으로 관찰하였다. 이후 100% isopropyl alcohol로 염색된 지방을 추출하고 microplate reader (Multiskan FC, Thermo Fisher Scientific)로 492 nm 파장에서 흡광도를 측정하여 다음 식(2)로 상대적인 지방 축적율을 계산하였다.

Lipid accumulation (%)=Absorbance of sampleAbsorbance of control×100

Quantitative Real-Time PCR

유산균의 미역발효 추출물(UFM)이 3T3-L1 지방전구세포의 분화와 관련된 전사인자의 mRNA 발현 억제효과를 확인하기 위해 저해효과가 예상되는 유의적인 농도인 50, 100, 200 μg/ml로 처리하였다. 관심 유전자에 대한 primer의 염기서열은 Table 1에 나타내었다. 분화가 완료된 (Day 8) 3T3-L1 지방세포를 회수하여 Total RNA를 Accuprep® universal RNA kit (Bioneer, Republic of Korea)를 사용하여 추출하였다. 추출한 Total RNA는 세포 내 유전자 발현 정도를 알아보기 위해 Dyne One-step RT qPCR kit (Dyne Bio Inc., Republic of Korea)를 사용하여 cDNA 합성 및RT-qPCR 실험을 수행하였다[15]. 각 샘플의 housekeeping gene은 GAPDH를 이용하였다. PCR cycling 조건은 42℃에서 30분간 역전사 후 95℃ 30초, 95℃ 5분간 denaturation, 55℃ 10분간 annealing, 72℃ 30분간 extension을 총 40회진행하였다. PCR을 수행한 후 유전자 발현은 각 gene들의Ct 값을 이용하여 delta-delta-Ct (Δ ΔCt)법으로 계산하여 분석하였다.

Table 1 . Primer sequences used for RT-qPCR.

GenePrimer sequence
Forward primer (5’ → 3’)Reverse primer (5’ → 3’)
PPARγAGGCTTCCACTAGGAGTTCCCAACAGCTTCTCCTTCTC
C/EBPαCAAGAACAGCAACGAGTACCTTGACCAAGGAGCTCTCA
aP2GGATTTGGTCACCATCCGGTTTCACCTTCCTGTCGTCTGC
ACLAGGGTTTTGTGTCCACCTCTGCCAGCCTATACCACATAAGCCC
FASACCTCCAGTCGTGTGAGTATGCTAAAATGGGCATGGAGGGAC
GAPDHAACTTTGGCATTGTGGAAGGACACATTGGGGGTAGGAACA


통계처리

모든 실험결과는 평균 ± 표준편차로 표현하였으며, IBM SPSS (Ver. 23, IBM Corp., USA) 통계 프로그램을 이용하였다. 각 실험결과들은 일원배치 분산분석 중 Duncan’s t-test, Tukey’s HSD를 시행하여 유의적 차이를 비교하였다.통계적 유의성은 P-value < 0.05 수준에서 평가하였다.

결과 및 고찰

Go to

유산균을 이용한 미역발효의 프로파일

미역(U. pinnatifida)과 유산균을 이용한 발효방법은 선행연구 Kim [12]과 동일한 조건으로 수행하였다. 그 결과Fig. 1에서 발효 96 h동안 전처리 과정에서 추출된 laminarin과 fucose의 함량은 13.2−11.4 g/l와 0.39−0.23 g/l의 낮은 농도로 각각 감소하였다. 해조류로부터 유래된 올리고당(oligo-saccharides)을 lactic acid bacteria (LAB)가 활용하는 것을보여주는 연구는 적지만, Jin [16]은 갈조류 Laminaria japonica에서 유래된 α-gluco-oligosaccharides 를 이용하기 위한 특정 수송체 시스템(specific transporter system)을 L. plantarum 균주를 포함한 다양한 LAB 종에서 발견하였다.또한 Enterococcus, Leuconostoc, Pediococcus, Propionibacterium 및 Weissella와 같은 속에서 일부 종이 GABA를생성할 수 있다고 알려져 있다[17]. 본 연구에 사용된 L. mesenteroides SGL152는 GABA 농도가 0.05−0.08 g/l로 확인되어, GABA 생산균주로는 적합하지 않다고 판단된다. 한편, 유산균의 미역발효 broth를 동결건조 한 후 3 g 파우더/ 80% 에탄올 혼탁액을 2 h동안 환류 추출한 뒤 감압 추출농축 장치로 에탄올 추출물을 얻어 3T3-L1 세포 실험에 사용하였다.

Figure 1.The fermentation profiles of the U. pinnatifida fermentation by L. mesenteroides (UFM) with modified synthetic medium. Conditions: 30℃, 120 rpm for 96 h, 3% (w/v) MSG. Data are expressed as mean ± SEM.

유산균의 미역발효 추출물(UFM)의 세포 독성 평가

유산균의 미역발효 추출물(UFM)의 독성은 MTT assay 실험을 통해 3T3-L1 지방전구세포의 생존율에 미치는 영향을확인하였다. ISO 10993-5에 따르면[18], 세포 생존율이 80%이상인 경우 비세포독성으로 간주된다. 유산균의 미역발효추출물(UFM)을 대조군, 25, 50, 100, 200 μg/ml의 농도별로48시간 동안 처리한 결과, UFM은 가장 높은 농도인 200 μg/ml의 농도에서 86.9%의 생존률로 3T3-L1 지방전구세포에큰 독성을 보이지 않았다(Fig. 2). 이와 유사한 결과로 Oh [19]에서 미역, 다시마, 모자반, 톳 등의 에탄올 추출물을 50, 100, 200 μg/ml 농도로 처리하였을 때 지방세포에서 유의적인 독성이 생기지 않았으며, 따라서 해조류의 추출물은 세포독성에 크게 영향을 주지 않음을 알 수 있었다.

Figure 2.Cell viability of 3T3-L1 preadipocytes treated with U. pinnatifida fermentation by L. mesenteroides (UFM) extracts. Cytotoxicity of ethanol extracts of UFM was determined by MTT assay. Data are expressed as mean ± SEM. Cultures in basal medium served as control. Small letters indicate significant differences (p < 0.05, Duncan’s test).

유산균의 미역발효 추출물(UFM)의 Lipid Droplet 생성평가

유산균의 미역발효 추출물(UFM)이 3T3-L1 지방전구세포의 지방분화에 미치는 영향을 평가하기 위해 분화 시작과 함께 UFM을 50, 100, 200 μg/ml 농도별로 처리하여 분화를진행하였다. 8일간의 분화 유도 및 완료 시점에서 지방세포에 Oil Red O 염색을 진행하여 지방구의 형성 정도를 확인하였다(Fig. 3). 그 결과, 시료 처리하지 않은 양성대조군에비해 UFM를 처리한 군에서는 25 μg/ml을 제외한 모든 농도에서 지방 축적이 감소되는 것을 확인하였다. 즉, 50, 100, 200 μg/ml의 UFM 농도에서 각각 66.80%, 61.59%, 55.94%로 지방구 형성이 저하됨을 확인하였고, 그 중 200 μg/ml 농도에서 가장 큰 효과를 나타내었다. 이는 Kim [20]의 연구에서 미역의 에탄올 추출물이 40%의 지방 축적 억제 효과와 비슷하였고, 다양한 해조류 (갈조류, 홍조류, 녹조류)에서 생성된 다당류(laminarin, fucoidan)와 페놀 화합물(epigallocatechin gallate; EGCG)들이 항비만 효과가 보고되고 있다[21, 22]. 또한, Paray [23] 연구에서 Leuconostoc mesenteroides KS-TN11가 20−30%의 지방 축적 억제 효과가 있다고 보고된 것과 유사한 결과를 나타내었다. 따라서L. mesenteroides SGL152 유산균을 이용한 미역발효 추출물(UFM)이 지방세포 내 지방구 형성을 억제하여 지방축적감소에 우수한 시너지 효과가 있다는 것을 확인하였다.

Figure 3.Inhibitory effect of U. pinnatifida fermentation by L. mesenteroides (UFM) extracts on lipid accumulation (A) and light micrographs of ORO image (B) in 3T3-L1 adipocyte differentiation. Cultures in basal medium served as control. Small letters indicate significant differences (p < 0.05, Duncan’s test).

지방세포 분화 조절인자들의 발현에 미치는 영향

지방전구세포에서 지방세포로의 분화는 다양한 adipogenic transcription factor들의 작용과 조절에 의해 유발되는 것으로 알려져 있다[4]. 따라서 유산균의 미역발효 추출물(UFM)이 3T3-L1 지방세포 분화에 미치는 영향을 연구하기 위해지방 형성 과정에 관여하는 주요 전사 조절 인자 중 PPARγ, C/EBPα, AP2, FAS, ACL의 상대적인 mRNA 발현 수준을확인하였다. Fig. 4에서 나타난 바와 같이 대조군과 비교하여 UFM 처리군에서 PPARγ, C/EBPα, AP2, FAS, ACL의발현이 농도의존적으로 감소하는 것을 확인하였다. 이와 같은 결과는 유산균의 미역발효 추출물(UFM) 처리에 의해 지방세포분화의 발현이 저해되는 것으로 판단된다. PPARγ는지방전구세포에서 지방세포로의 분화를 촉진시키며, PPARγ의 발현량 감소는 지방세포의 감소를 의미한다[24−26]. 또한PPARγ와 C/EBPα의 협력적인 상호작용은 지방형성 및 지방세포 특이적인 형질의 생성과 유지에 필요한 adipocyte-specific fatty acid binding protein (aP2), fatty Acid Synthase (FAS)와 ATP citrate lyase (ACL)의 발현을 조절하는 데 관여하며, 이들의 협력적인 상호작용은 지방세포의 분화 및 지방산 합성에 중요한 역할을 한다[27−30].

Figure 4.Effect of U. pinnatifida fermentation by L. mesenteroides (UFM) extracts on PPARγ, C/EBPα, AP2, FAS, and ACL in adipocytes determined by RT-qPCR analysis. GAPDH was used as an internal control. Capital and small letters indicate significant differences (p < 0.05, Duncan’s test). AC: Adipocyte

요약

Go to

유산균 L. mesenteroides SGL152를 이용한 미역발효 추출물로부터 3T3-L1 지방세포 분화에 미치는 영향을 살펴보기 위해 MTT assay, Oil Red O staining, RT-qPCR 실험을 진행하였다. 유산균의 미역발효 추출물(UFM)의 농도별세포 독성 실험 결과, 200 μg/ml 농도 이하에서는 비세포독성으로 판단된다. 또한 3T3-L1 지방세포 분화와 동시에 추출물을 농도별로 처리하여 분화를 진행한 결과, 대조군과 비교하여 유의적으로 지방구 형성 및 지방분화를 억제하였다.이러한 연구결과는 유산균을 이용한 해조류 발효과정 및 복합추출물에 있어서 유용한 정보를 제공할 것으로 판단된다.

Acknowledgments

Go to

This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIT)(No.2022R1F1A1074594).

Conflict of Interest

Go to

The authors have no financial conflicts of interest to declare.

References

Go to
  1. Lee H, Yang J, Karadeniz F, Oh JH, Choi MN, Jeon S, et al. 2022. Inhibitory effects of extract and solvent fractions from Rosa rugosa on 3T3-L1 adipocyte differentiation. J. Life Sci. 32: 979-988.
  2. Hong JW, Park HY, Park JH, Kim SH, Kim HA, Kim JW. 2022. Inhibition of lipase activity and preadipocyte differentiation in 3T3-L1 cells treated with Sargassum horneri extract. Ocean Polar Res. 44: 61-67.
  3. Rosen ED, Hsu CH, Wang X, Sakai S, Freeman MW, Gonzalez FJ, et al. 2002. C/EBPα induces adipogenesis through PPARγ: A unified pathway. Genes Dev. 16: 22-26.
    CrossRef
  4. Rosen ED, Walkey CJ, Puigserver P, Spiegelman BM. 2000. Transcriptional regulation of adipogenesis. Genes Dev. 14: 1293-1307.
    Pubmed CrossRef
  5. Kim GH, Lee SY, Lee AR. 2019. The effect of Selaginella tamariscina on inhibition of pancreatic lipase and lipid accumulation. J. Korean Soc. Food Sci. Nutr. 32: 27-32.
  6. Lee SG, Hahn D, Kim SR, Lee WY, Nam JO. 2020. Elephant garlic extracts inhibit adipogenesis in 3T3-L1 adipocytes. Microbiol. Biotechnol. Lett. 48: 377-382.
    CrossRef
  7. Kim SK, Kim NK, Yoon DH, Kim TH, Yang BK, Lee HJ. 2010. Gene expression of candidate genes involved in fat metabolism during in vitro adipogenic differentiation of bovine mesenchymal stem cell. J. Anim. Sci. Technol. 52: 265-270.
    CrossRef
  8. Lee HH, Kim JS, Jeong JH, Kim CS, Lee SY. 2023. Comparative analysis of antioxidant, anti aging and phenolic compounds of different solvent extracts from Saccharina japonica and Costaria costata. Korean J. Plant Res. 36: 107-121.
  9. Shin SH, Kang SM. 2021. The antioxidation effect of brown algae extract. J. Korean Soc. Cosmetol. 27: 851-858.
    CrossRef
  10. Choi SW, Jung EA. 2022. In vitro probiotic evaluation and antiadipogenic effect of lactic acid bacteria isolated from Kimchi. Curr. Top. Lact. Acid Bact. Probiotics 8: 59-65.
    CrossRef
  11. Hyun IK, Hong SW, Ma MJ, Chang JY, Lee SS, Yun YR. 2024. Antiobesity effect of Kimchi with starter cultures in 3T3-L1 cells. J. Microbiol. Biotechnol. 34: 123-131.
    Pubmed KoreaMed CrossRef
  12. Kim NY, Kim JM, Son JY, Ra CH. 2023. Synbiotic fermentation of Undaria pinnatifida and Lactobacillus brevis to produce prebiotics and probiotics. Appl. Biochem. Biotechnol. 195: 6321-6333.
    Pubmed CrossRef
  13. Sim EA, Oh HH, Jeong DY, Song GS, Kim YS. 2021. Fermentation characteristics and inhibitory effect of brown rice vinegar on adipocyte differentiation in 3T3-L1 cells. Food Sci. Preserv. 28: 416-425.
    CrossRef
  14. Gu YR, Hong JH. 2020. Antioxidant activity and anti-adipogenic effects of acai berry (Euterpe oleracea Mart.) juice and extracts. J. Korean Soc. Food Sci. Nutr. 49: 1184-1193.
    CrossRef
  15. Ji SB, Ra CH. 2023. Effect of solid-state fermented brown rice extracts on 3T3-L1 adipocyte differentiation. J. Microbiol. Biotechnol. 33: 926-933.
    Pubmed KoreaMed CrossRef
  16. Jin Z, Ma Q, Chen X, Wang H, Zhu J, Lee YK, et al. 2022. An α type gluco-oligosaccharide from brown algae Laminaria japonica stimulated the growth of lactic acid bacteria encoding specific ABC transport system components. Food. Funct. 13: 11153-11168.
    Pubmed CrossRef
  17. Cui Y, Miao K, Niyaphorn S, Qu X. 2020. Production of gammaaminobutyric acid from lactic acid bacteria: A systematic review. Int. J. Mol. Sci. 21: 995.
    Pubmed KoreaMed CrossRef
  18. ISO 10993-5: 2009. Biological Evaluation of Medical Devices. Part 5: Tests for In Vitro Cytotoxicity. International Organization for Standardization; Geneva, Switzerland.
  19. Oh JH, Lee Y. 2015. Effects of water and ethanol extracts from four types of domestic seaweeds on cell differentiation in 3T3-L1 cell line. J. East Asian Soc. Diet Life 25: 990-998.
    CrossRef
  20. Kim H, Kang CH, Kim SK. 2012. Anti-adipogenic effect of Undaria pinnatifida extracts by ethanol in 3T3-L1 adipocytes. J. Life Sci. 22: 1052-1056.
    CrossRef
  21. Rodríguez-Pérez C, Segura-Carretero A, del Mar Contreras M. 2019. Phenolic compounds as natural and multifunctional anti-obesity agents: a review. Crit. Rev. Food Sci. Nutr. 59: 1212-1229.
    Pubmed CrossRef
  22. Kim KJ, Lee BY. 2012. Fucoidan from the sporophyll of Undaria pinnatifida suppresses adipocyte differentiation by inhibition of inflammation-related cytokines in 3T3-L1 cells. Nutr. Res. 32: 439-447.
    Pubmed CrossRef
  23. Paray BA, Rather IA, Al-Sadoon MK, Hamad ASF. 2018. Pharmaceutical significance of Leuconostoc mesenteroides KS-TN11 isolated from Nile Tilapia, Oreochromis niloticus. Saudi Pharm. J. 26: 509-514.
    Pubmed KoreaMed CrossRef
  24. Cao Z, Umek RM, McKnight SL. 1991. Regulated expression of three C/EBP isoforms during adipose conversion of 3T3-L1 cells. Genes Dev. 5: 1538-1552.
    Pubmed CrossRef
  25. Yeh WC, Cao Z, Classon M, McKnight SL. 1995. Cascade regulation of terminal adipocyte differentiation by three members of the C/EBP family of leucine zipper proteins. Genes Dev. 9: 168-181.
    Pubmed CrossRef
  26. Wu Z, Rosen ED, Brun R. 1999. Cross-regulation of C/EBP alpha and PPAR gamma controls the transcriptional pathway of adipogenesis and insulin sensitivity. Mol. Cell 3: 151-158.
    Pubmed CrossRef
  27. Darlington GJ, Ross SE, MacDougald OA. 1998. The role of C/EBP genes in adipocyte differentiation. J. Biol. Chem. 273: 30057-30060.
    Pubmed CrossRef
  28. Tong Q, Hotamisligil GS. 2001. Molecular mechanisms of adipocyte differentiation. Rev. Endocr. Metab. Disord. 2: 349-355.
    Pubmed CrossRef
  29. Tontonoz P, Hu E, Spiegelman BM. 1994. Stimulation of adipogenesis in fibroblasts by PPARγ2, a lipid-activated transcription factor. Cell 79: 1147-1156.
    CrossRef
  30. Kim JB, Wright HM, Wright M, Spiegelman BM. 1998. ADD1/SREBP1 activates PPARγ through the production of endogenous ligand. Proc. Natl. Acad. Sci. USA 95: 4333-4337.
    KoreaMed CrossRef

Article Tools

Starts of Metrics

Share this article on :

Related articles in MBL

Most Searched Keywords ?

What is Most Searched Keywords?

  • It is most registrated keyword in articles at this journal during for 2 years.