Contact us
닫기
Article Search
닫기

Microbiology and Biotechnology Letters

Research Article(보문)

View PDF

Molecular and Cellular Microbiology  |  Microbial Genetics, Physiology and Metabolism

Microbiol. Biotechnol. Lett. 2023; 51(4): 500-506

https://doi.org/10.48022/mbl.2310.10005

Received: October 11, 2023; Revised: December 7, 2023; Accepted: December 9, 2023

Carbapenem 내성 Klebsiella pneumoniae ST307과 Non-ST307의 분자 특성 및 항균제 내성 비교

Comparison of Molecular Characterization and Antimicrobial Resistance in Carbapenem-Resistant Klebsiella pneumoniae ST307 and Non-ST307

Hye Hyun Cho*

Department of Biomedical Laboratory Science, Daejeon Institute of Science and Technology, Daejeon 35408, Republic of Korea

Correspondence to :
Hye Hyun Cho,      airplane1102@hanmail.net

Abstract

Go to

Carbapenem-resistant Klebsiella pneumoniae (CRKP) is emerging as a worldwide public health threat. Recently, Klebsiella pneumoniae carbapenemase-2 (KPC-2)-producing sequence type (ST) 307 was identified main clone of CRKP, and dissemination of ST307 was reported in South Korea. This study examined the molecular characteristic and antimicrobial resistance pattern of 50 CRKP isolated from a tertiary hospital in Daejeon, from March 2020 to December 2021. Epidemiological relationship was analyzed by Multilocus sequence typing (MLST) and antimicrobial susceptibility test was determined using disk-diffusion method. PCR and DNA sequence analysis were performed to identify carbapenemase genes. CRKP infections were significantly more frequent in males and the patients aged ≥ 60 years. Among the 50 CRKP isolates, 46 isolates (92.0%) were multidrug-resistant (MDR), and 44 isolates (88.0%) were carbapenemase-producing K. pneumoniae (CPKP). The major carbapenemase type was KPC-2 (36 isolates, 72.0%) and New Delhi metallo-enzyme-1 (NDM-1) and NDM-5 were identified in 7 isolates (14.0%) and 1 isolate (2.0%), respectively. In particular, 88.9% (32/36) of KPC-2-producing K. pneumoniae belonged to ST307, whereas 87.5% (7/8) of NDM-1,-5-producing K. pneumoniae belonged to non-ST307. These results suggest that proper infection control and effective surveillance network need to prevent not olny the spread of ST307, but also the development of non-ST307.

Keywords: β-lactamase KPC-2, CRKP, ST307

서 론

Go to

Carbapenem-resistant Klebsiella pneumoniae (CRKP)는 1990년대에 처음 보고되었으며, 그 이후로 10년 동안 산발적으로 확인되었다[1]. 그러나 최근 몇 년 동안 carbapenem의 임상적 사용이 증가함에 따라 CRKP의 급격한 확산이 보고되었다[2]. 또한, CRKP는 다제내성(multidrug-resistant, MDR), 광범위내성(extensively drug-resistant, XDR) 또는범약제내성(pandrug-resistant, PDR)으로 확인되어, CRKP 감염 환자의 치료에 사용가능한 항균제가 제한되므로, 전 세계적으로 심각한 문제가 되고 있다[3]. 미국질병통제예방센터(Centers for Disease Control and Prevention, CDC)의발표에 따르면, carbapenem-resistant Enterobacteriaceae (CRE)를 긴급 위협으로 분류하였다[4, 5]. CRKP에서 가장 흔한 carbapenem 내성 기전은 carbapenemase의 생성으로 보고되고 있으며, 전 세계적으로 K. pneumoniae carbapenemase (KPC)와 New Delhi metallo-β-lactamase (NDM)가 주요유형으로 확인되었다[5, 6]. 국내에서는 KPC-2가 가장 유행하는 carbapenemase로 확인되었고, KPC-2 생성 K. pneumoniae의 주요 클론으로 clonal complex (CC) 258에속하는 sequence type (ST) 258, ST11이 순차적으로 보고되었다[7, 8]. 2009년 국내에서 처음으로 보고된 ST258은 현재 전 세계적으로 가장 널리 전파된 CC258의 대표적인 ST로 확인되었으며, ST11은 ST258의 single locus variant로,유럽 전역, 아시아, 라틴 아메리카에서 주요 클론으로 보고되고 있다[9, 10]. 그러나, 최근 ST258, ST11과 달리, 계통· 유전학적으로 non-CC258에 속하는 ST307의 집단발생과 확산이 확인되고 있다[11, 12]. 앞서 이탈리아에서 발표한 연구에서도 2008년 ST258이 처음 확인되었고 주요 클론으로보고되었으나, 2014년 이후 CC258과 함께 ST307의 확산이보고되었다[13]. 이는 시간이 지남에 따라 특정 클론의 진화와 새로운 클론의 출현 및 확산을 의미하므로, 주요 클론의특징과 변화를 추적하고 감시하기 위한 지속적인 연구가 요구된다.

본 연구에서는 대전지역의 3차 병원에서 분리된 carbapenem내성 K. pneumoniae 50균주를 대상으로, 다좌위 서열 형별분석(multilocus sequence typing, MLST)을 통한 ST를 확인하여 주요 클론과 그 외 클론의 역학적 특징과 항균제 내성 양상을 비교 분석하고자 한다.

재료 및 방법

Go to

균주의 수집과 동정

본 연구는 2020년 3월부터 2021년 12월까지 대전지역의3차 병원에서 분리된 CRKP 50균주를 대상으로 하였다. 임상검체로부터 분리 배양된 균주는 Vitek 2 automated ID system (BioMerieux, USA)을 이용하여 동정하였고, ertapenem, imipenem 및 meropenem에 내성인 균주를CRKP로 선별하였다.

항균제 감수성 검사

항균제 감수성 검사는 Clinical and Laboratory Standards Institute (CLSI) 지침에 따라[14], 12 종류의 항균제(amikacin, gentamicin, ceftazidime, cefotaxime, cefepime, ertapenem, imipenem, meropenem, ciprofloxacin, chloram-phenicol, tigecycline, trimethoprim/sulfamethoxazole (BioMerieux))에 대해 디스크 확산법으로 확인하였다. Escherichia coli ATCC 25922와 Pseudomonas aeruginosa ATCC 27853을 시험하여 허용범위 내에 있는지 확인하였다. 앞선 연구[15]를 참고하여, aminoglycosides, 광범위cephalosporins, carbapenems 및 fluoroquinolones 계열의항균제 중 3 계열 이상의 항균제에 내성을 보인 균주를 다제내성 CRKP로 하였다.

MLST 분석

CRKP로 확인된 균주는 brain heart infusion broth (Difco, USA)에 접종하여 37℃에서 24시간 배양한 후, Genomic DNA Prep Kit (Solgent, Republic of Korea)를 사용하여DNA를 추출하였다. DNA 추출액(5 μl), 10x Taq buffer (2.5 μl), 10 mM dNTP mix (0.5 μl), primer 각 10 pmol, 0.7 U Taq DNA polymerase (Solgent) 및 증류수를 혼합하여 총 부피 25 μl의 반응용액을 만들었다. 7개의 housekeeping gene (rpoB, gapA, mdh, pgi, phoE, infB, tonB)에 대한 PCR 과정은 Gene Amp PCR System 9600 (Perkin-Elmer, USA)을 사용하여 94℃에서 2분간predenaturation한 후, 95℃에서 20초 denaturation, 50℃(60℃ 또는 45℃)에서 30초 annealing, 72℃에서 30초extension 과정을 35회 반복하고, 72℃에서 5분간 final extension을 시행하였다. 각각의 PCR 반응산물은 1%agarose gel에서 30분간 전기영동하여 증폭산물을 확인하였고, PCR purification kit (Solgent)로 분리한 후, BigDye Terminator cycle sequencing kit (PE Applied Biosystems, USA)와 ABI PRISM 3730xl DNA analyzer (PE Applied Biosystems)를 이용하여 염기서열을 분석하였다.

MLST 분석은 https://bigsdb.pasteur.fr/klebsiella/에 설명된 방법을 참고하여, 7개의 housekeeping gene에 대한 염기서열 분석 결과를 MLST database에 입력하여 allelic number와 ST를 확인하였다.

Carbapenemase의 검출

Carbapenemase 유전자의 검출을 확인하기 위해, 이전 연구에서 사용한 primer (Table 1)를 이용하여 PCR을 수행하였다[16]. 앞서 MLST 분석과 동일한 방법으로, DNA 추출액(5 μl), 10x Taq buffer (2.5 μl), 10 mM dNTP mix (0.5 μl), primer 각 10 pmol, 0.7 U Taq DNA polymerase (Solgent) 및증류수를 혼합하여 총 부피 25 μl의 반응용액을 만들었다. PCR 과정은 94℃에서 10분간 predenaturation한 후, 94℃에서 30초 denaturation, 52℃에서 40초 annealing, 72℃에서 50초 extension 과정을 35회 반복하고, 72℃에서 5분간final extension을 시행하였다. 각 PCR 반응산물은 1%agarose gel에서 30분간 전기영동하여 증폭산물을 확인하였고, PCR purification kit (Solgent)로 분리한 후, BigDye Terminator cycle sequencing kit (PE Applied Biosystems)와ABI PRISM 3730xl DNA analyzer (PE Applied Biosystems)를이용하여 염기서열을 분석하였다. 염기서열 분석 결과는NCBI에서 제공하는 BLAST 프로그램을 이용하여 E. coli ATCC 25922와 비교 분석하였다.

Table 1 . Oligonucleotides primers used in current study.

GeneSequence (5’-3’)Annealing temperature (℃)Product size (bp)
Carbapenemase gene primers
blaIMPF: GGAATAGAGTGGCTTAAYTCTC
R: GGTTTAAYAAAACAACCACC		52232
blaVIMF: GATGGTGTTTGGTCGCATA
R: CGAATGCGCAGCACCAG		52390
blaOXA-48F: GCGTGGTTAAGGATGAACAC
R: CATCAAGTTCAACCCAACCG		52438
blaNDMF: GGTTTGGCGATCTGGTTTTC
R: CGGAATGGCTCATCACGATC		52621
blaKPCF: CGTCTAGTTCTGCTGTCTTG
R: CTTGTCATCCTTGTTAGGCG		52798

결 과

Go to

CRKP의 MLST 분석

총 50균주의 CRKP를 대상으로 MLST를 시행한 결과, 총 8개의 ST를 확인하였다(Table 2). 8개의 ST 중 가장 흔한 유형은 ST307이었고, 총 50균주 중 39균주(78.0%)에서 확인되었다. 그 다음으로 ST48과 ST147이 각각 3균주(6.0%)에서 확인되었고, ST25, ST714, ST1114, ST1944, ST5220은각각 1균주(2.0%)에서 확인되었는데, 이는 non-ST307에 해당되었다.

Table 2 . MLST analysis of 50 carbapenem-resistant Klebsiella pneumoniae.

STAllelic profileNo. of isolates (%)
rpoBgapAmdhpgiphoEinfBtonB
3071425211739 (78.0)
48122275103 (6.0)
147436174383 (6.0)
254211101131 (2.0)
7144222631601 (2.0)
11144421103171 (2.0)
1944115216911821 (2.0)
52201817222030191621 (2.0)

Abbreviations: MLST, multilocus sequence typing; ST, sequence type.

CRKP 감염 환자의 성별, 연령별 분포 확인

2020년 3월부터 2021년 12월까지 대전지역의 3차 병원에입원한 CRKP 감염 환자 50명을 대상으로 성별 분포를 확인한 결과, 남성 30명(60.0%), 여성 20명(40.0%)으로, 남성이 여성보다 1.5배 높은 분포를 보였다(Table 3). 또한, 연령별 분포를 확인한 결과, 70대에서 총 50명 중 13명(26.0%)이 확인되어 가장 높은 분포를 보였다. 순차적으로 60대와80대가 각각 11명(22.0%), 50대가 8명(16.0%), 40대와 90대가 각각 3명(6.0%), 10대 미만이 1명(2.0%)의 분포를 보였다. 성별에 따른 연령 분포를 확인하면, 남성은 70대(33.3%, 10명), 여성은 80대(25.0%, 5명)에서 가장 높은 빈도를 보였다. 또한, ST307과 non-ST307에 따른 성별 분포에서 ST307이 확인된 환자 39명 중 남성은 23명(59.0%), 여성은 16명 (41.0%)이었고, non-ST307이 확인된 환자 11명 중 남성은7명(63.6%), 여성은 4명(36.4%)으로, 모두 남성이 여성보다각각 약 1.4배, 1.7배 높은 분포를 보였다.

Table 3 . Distribution of gender and age between ST307 and non-ST307 CRKP isolates.

Age groupNo. of isolates (%)
TotalST307Non-ST307
TotalMFTotalMFTotalMF
1~91 (2.0)1 (3.3)0 (0.0)0 (0.0)0 (0.0)0 (0.0)1 (9.1)1 (14.3)0 (0.0)
10~190 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)
20~290 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)
30~390 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)
40~493 (6.0)1 (3.3)2 (10.0)2 (5.1)1 (4.3)1 (6.3)1 (9.1)0 (0.0)1 (25.0)
50~598 (16.0)5 (16.7)3 (15.0)7 (17.9)4 (17.4)3 (18.8)1 (9.1)1 (14.3)0 (0.0)
60~6911 (22.0)7 (23.3)4 (20.0)9 (23.1)6 (26.1)3 (18.8)2 (18.2)1 (14.3)1 (25.0)
70~7913 (26.0)10 (33.3)3 (15.0)11 (28.2)9 (39.1)2 (12.5)2 (18.2)1 (14.3)1 (25.0)
80~8911 (22.0)6 (20.0)5 (25.0)8 (20.5)3 (13.0)5 (31.3)3 (27.3)3 (42.9)0 (0.0)
90~993 (6.0)0 (0.0)3 (15.0)2 (5.1)0 (0.0)2 (12.5)1 (9.1)0 (0.0)1 (25.0)
Total50 (100.0)30 (100.0)20 (100.0)39 (100.0)23 (100.0)16 (100.0)11 (100.0)7 (100.0)4 (100.0)

Abbreviations: ST, sequence type; M, male; F, female.

ST307과 non-ST307에 따른 성별 및 연령별 분포에서, ST307이 확인된 환자는 70대(28.2%)에서 가장 높은 분포를보였으나, non-ST307이 확인된 환자는 80대(27.3%)로 확인되었다. ST307이 확인된 환자 중 남성은 70대, 여성은 80대에서 가장 높은 분포를 보였고, non-ST307이 확인된 환자 중남성은 80대에서 가장 높은 분포를 보인 반면, 여성은 40대, 60대, 70대, 90대에서 고른 분포를 보였다.

CRKP 균주의 검체별 분포 확인

임상 검체의 종류에 따라 CRKP 50균주를 분리한 결과, 41균주(82.0%)가 대변(직장도말검체 포함)에서 가장 많이 분리되었으며, 다음으로 객담과 소변에서 각각 4균주(8.0%), 담즙에서 1균주(2.0%)가 확인되었다(Table 4). 대변(직장도말검체 포함)은 ST307과 non-ST307에서 각각 89.7%(35/39), 54.5%(6/11)로 가장 높은 비율로 확인되었다. 객담의 경우, non-ST307에서 36.4%(4/11)로 두 번째로 높은 비율로 확인되었으나, ST307에서는 전혀 확인되지 않았고, 소변에서7.7%(3/39)가 분리되어 순차적으로 높은 검체로 확인되었다.

Table 4 . Distribution of specimen between ST307 and non-ST307 CRKP isolates.

SpecimenNo. of isolates (%)
TotalST307Non-ST307
Stool41 (82.0)35 (89.7)6 (54.5)
Sputum4 (8.0)0 (0.0)4 (36.4)
Urine4 (8.0)3 (7.7)1 (9.1)
Bile1 (2.0)1 (2.6)0 (0.0)
Total50 (100.0)39 (100.0)11 (100.0)

Abbreviations: ST, sequence type.

CRKP 균주의 carbapenemase 분포 확인

Carbapenemase 생성을 확인한 결과, 총 50균주의 CRKP중 44균주(88.0%)가 carbapenemase-producing K. pneumoniae (CPKP)로 확인되었다(Table 5). 이 중 36균주(72.0%)에서 KPC-2가 확인되었고, 순차적으로 7균주(14.0%)에서 NDM-1이 확인되었으며, 1균주(2.0%)에서 NDM-5가 확인되었다.또한, 6균주(12.0%)는 carbapenemase를 생성하지 않는 것으로 확인되었다. ST307에서 KPC-2와 NDM-1이 확인되었고, 이 중 KPC-2가 82.1%(32/39)의 높은 비율로 확인된 반면, non-ST307에서 KPC-2, NDM-1, NDM-5가 확인되었고, NDM-1이 54.5%(6/11)로 가장 높은 비율로 확인되었다.

Table 5 . Distribution of carbapenemase between ST307 and non-ST307 CRKP isolates.

CarbapenemaseNo. of isolates (%)
TotalST307Non-ST307
KPC-236 (72.0)32 (82.1)4 (36.4)
NDM-17 (14.0)1 (2.6)6 (54.5)
NDM-51 (2.0)0 (0.0)1 (9.1)
Negative6 (12.0)6 (15.4)0 (0.0)
Total50 (100.0)39 (100.0)11 (100.0)

Abbreviations: ST, sequence type.

항균제 감수성 양상 확인

총 50 균주의 CRKP를 대상으로 항균제 감수성 검사를 실시한 결과, ceftazidime, cefotaxime, ertapenem, imipenem, meropenem에 50균주(100%) 모두 내성을 보였으며, 순차적으로 cefepime 98.0%(49균주), ciprofloxacin 92.0%(46균주)의 높은 내성을 보였다(Table 6). 또한, trimethoprim/sulfamethoxazole 88.0%(44균주), gentamicin 64.0%(32균주), chloramphenicol 44.0%(22균주)의 내성을 보였고, tigecycline은 14.0%(7균주)의 비교적 낮은 내성을 보였으며, amikacin은 50균주(100.0%) 모두 감수성을 보였다. ST307과 non-ST307의 항균제 감수성 결과를 비교해보면, ST307이 ciprofloxacin과 trimethoprim/sulfamethoxazole에 39균주(100.0%) 모두 내성을 보인 반면, non-ST307은 각각63.6%(7균주), 45.5%(5균주)의 내성을 보였다. 흥미롭게도gentamicin의 경우, ST307은 71.8%(28균주)의 내성을 보였으나, non-ST307은 63.6%(7균주)의 감수성을 보였다. 또한, tigecycline에서 non-ST307(81.8%, 9균주)은 ST307 (69.2%, 27균주)보다 12.6% 높은 감수성을 보였다.

Table 6 . Antimicrobial susceptibility pattern between ST307 and non-ST307 CRKP isolates.

Antimicrobial agentsNo. of isolates (%)
Total (N=50)ST307 (N=39)Non-ST307 (N=11)
SIRSIRSIR
Amikacin50 (100.0)0 (0.0)0 (0.0)39 (100.0)0 (0.0)0 (0.0)11 (100.0)0 (0.0)0 (0.0)
Gentamicin17 (34.0)1 (2.0)32 (64.0)10 (25.6)1 (2.6)28 (71.8)7 (63.6)0 (0.0)4 (36.4)
Ceftazidime0 (0.0)0 (0.0)50 (100.0)0 (0.0)0 (0.0)39 (100.0)0 (0.0)0 (0.0)11 (100.0)
Cefotaxime0 (0.0)0 (0.0)50 (100.0)0 (0.0)0 (0.0)39 (100.0)0 (0.0)0 (0.0)11 (100.0)
Cefepime0 (0.0)1 (2.0)49 (98.0)0 (0.0)0 (0.0)39 (100.0)0 (0.0)1 (9.1)10 (90.9)
Ertapenem0 (0.0)0 (0.0)50 (100.0)0 (0.0)0 (0.0)39 (100.0)0 (0.0)0 (0.0)11 (100.0)
Imipenem0 (0.0)0 (0.0)50 (100.0)0 (0.0)0 (0.0)39 (100.0)0 (0.0)0 (0.0)11 (100.0)
Meropenem0 (0.0)0 (0.0)50 (100.0)0 (0.0)0 (0.0)39 (100.0)0 (0.0)0 (0.0)11 (100.0)
Ciprofloxacin4 (8.0)0 (0.0)46 (92.0)0 (0.0)0 (0.0)39 (100.0)4 (36.4)0 (0.0)7 (63.6)
Chloramphenicol10 (20.0)18 (36.0)22 (44.0)6 (15.4)18 (46.2)15 (38.5)4 (36.4)0 (0.0)7 (63.6)
Tigecycline36 (72.0)7 (14.0)7 (14.0)27 (69.2)6 (15.4)6 (15.4)9 (81.8)1 (9.1)1 (9.1)
Trimethoprim/sulfamethoxazole6 (12.0)0 (0.0)44 (88.0)0 (0.0)0 (0.0)39 (100.0)6 (54.5)0 (0.0)5 (45.5)

Abbreviations: ST, sequence type; S, susceptible; I, intermediate resistant; R, resistant.

고 찰

Go to

최근 세계보건기구(WHO)는 extended spectrum β-lactamase (ESBL) 및 carbapenem 내성 K. pneumoniae를중요한 공중 보건 위협으로 보고하였다[17]. 또한 CRKP에서 확인된 특정 클론의 출현과 유행이 전 세계적으로 항균제 내성 결정인자의 보급과 확산에 중요한 수단으로 보고되고 있다[18]. 국내 또한 CRKP의 집단발병과 특정 클론의 확산이 증가추세를 보이고 있어, 심각한 우려를 낳고 있다.

본 연구에서 대전지역의 3차 병원에 입원한 50명의 CRKP감염 환자 중 남성이 30명(60%)으로, 여성보다 1.5배 높은분포를 보였으며, 38명(76%)의 환자가 60세 이상으로 확인되었다. 앞서 2015년에 발표한 Chang 등의 연구와 2017년에 발표한 Zheng 등의 연구에서 남성이 여성보다 각각 약1.5배, 2.2배 높은 분포를 보였고, 65세 이상의 환자가 확인되어 유사한 결과를 보였다[3, 19]. 이는 CRKP 감염이 남성과 면역기능이 감소한 노인 환자에서 취약한 것으로 판단된다.

역학관계 확인을 위해 CRKP 50균주를 대상으로 MLST를 실시한 결과, ST307이 78.0% (39/50)로 가장 흔한 유형으로 확인되었다. 그 외 non-ST307은 22.0% (11/50)로 확인되었는데, 순차적으로 ST48, ST147, ST25, ST714, ST1114, ST1944, ST5220이 포함되었다. ST307과 non-ST307의 성별, 연령별 분포를 비교하면, ST307은 70대 남성에서, non-ST307은 80대 남성에서 가장 높은 분포를 보였다.

또한, CRKP 50균주 중 CPKP는 88.0% (44/50)로 확인되었는데, KPC-2가 72.0% (36/50), NDM-1이 14.0% (7/50), NDM-5가 2.0% (1/50)로 확인되었다. 2010년 국내에서KPC-2가 처음 보고된 이후, 많은 연구에서 KPC-2는 국내에서 분리된 K. pneumoniae에서 가장 흔한 유형으로 보고되고 있다[9, 10, 20]. 최근 KPC-2 생성 K. pneumoniae의 주요 클론으로, ST307이 보고되고 있으며, 국내에서 ST307의집단발병과 빠른 확산이 확인되었다[10, 21].

ST307은 2008년 네덜란드에서 제출한 MLST database (https://bigsdb.pasteur.fr/klebsiella/klebsiella.html)에 처음 정의되었으며, 이후 2013년 미국과 파키스탄에서 발표한첫 연구가 보고되었다[17, 22]. 최근 ST307은 이탈리아, 콜롬비아, 미국, 남아프리카 공화국의 풍토병으로 보고되었으며, 다양한 ESBL (CTX-M-15) 및 carbapenemases (KPC, NDM, OXA-48-like 및 VIM)에 대한 관련 연구가 전 세계적으로 증가하고 있다[17].

또한, 본 연구에서 KPC-2가 ST307에서 88.9%(32/36)로확인된 반면, NDM-1,-5는 non-ST307에서 87.5% (7/8)로 우세한 결과를 보였으며, 5개의 ST (ST147, ST714, ST1114, ST1944, ST5220)에서 확인되었다. 이와 유사하게, 2022년중국에서 발표한 Fu 등의 연구에서 KPC는 ST11에서 우세하게 확인되었으나, NDM은 하나의 특정 클론이 아닌, 20개의 ST에서 다양한 결과를 보였다[23]. 2019년 Wu 등이 발표한 연구에서도, CC258에 의해 전 세계적으로 확산되고 있는 KPC-2 생성 K. pneumoniae와 달리, NDM 생성 K. pneumoniae는 우세한 계통이 없이 많은 ST 유형에 분포하고 있으며, 비교적 흔한 클론으로, ST11, ST14, ST15 ST23및 ST147이 여러 국가에서 보고됨을 확인하였다[24].

NDM-1은 2009년 인도에서 K. pneumoniae에서 처음 분리되었고, 이후 전 세계적으로 가장 널리 퍼진 유형으로, 중국, 콜롬비아, 이탈리아, 브라질에서 보고되고 있다[25]. NDM-5는 두 개의 아미노산 치환(Val88Leu 및 Met154Leu)이 NDM-1과 다르며, carbapenems과 expanded-spectrum cephalosporins에 대한 내성 증가가 보고되었다. 또한, 주로E. coli에서 확인되었고, K. pneumoniae 및 기타 장내세균에서는 드물게 보고되었다[26].

더불어, 아직까지 국내에서는 보고되지 않았으나, 최근몇 년 동안 2 종류의 carbapenemase를 생성하는 K. pneumoniae에 대한 보고가 증가하고 있다. 특히, KPC-2와NDM-1 공동 생성 K. pneumoniae가 중국(50.5%), 미국(25.2%) 및 러시아(5.8%)에서 우세하게 확인되었으며, 주요ST 유형으로 중국에서 ST11 (95.2%, 40/42), 미국에서ST258 (100%, 8/8), 러시아에서 ST39 (66.7%, 6/9)가 가장흔한 것으로 확인되었다[25].

CRKP 감염에 대한 항균제 선택과 치료가 제한적인 가운데, 본 연구에서 CRKP 50균주 중 92.0% (46/50)가 다제내성으로 확인되었다. 2022년 이집트에서 발표한 Elmanakhly등의 연구에서도 CRKP 41균주가 모두 다제내성으로 확인되어 본 연구 결과와 유사한 결과를 보였다[27]. Ciprofloxacin (100.0% vs 63.6%), trimethoprim/sulfamethoxazole (100.0%vs 45.5%)과 gentamicin (71.8% vs 36.4%)에 대한 내성은non-ST307보다 ST307에서 더 높은 결과를 보였다. 또한, tigecycline에 대한 내성은 14.0%로 확인되었는데, 앞서 대만과 국내에서 보고한 연구에서도 CRKP에 대한 tigecycline의 내성율이 각각 9.0%, 14.5%로 확인되었다[28, 29]. Tigecycline은 CRKP 감염의 치료를 위해 사용될 수 있는 최후의 항균제 중 하나로, tigecycline의 내성 증가는 심각한 문제를 야기할 수 있으므로, 이에 대한 철저한 감염관리가 요구된다.

1996년 미국에서 KPC 생성 K. pneumoniae가 처음 동정된 이후, 우세한 클론인 CC258이 전 세계적으로 빠르게 확산되었는데, 이는 국내도 예외가 아니다[30]. 2009년 국내에서 처음으로 확인된 ST258과 2014년 이후 급격한 확산세를보인 ST11은 모두 CC258에 속하는 클론이었다[10]. 그러나최근 국내에서 유행하고 있는 주요 클론인 ST307은 non-CC258으로, 새로운 클론의 출현과 확산이 빠르게 변화하고있음을 의미한다. 또한, ST307의 유행 이후 또 다른 클론의등장이 우려되는 가운데, non-ST307의 발달과 확산을 간과해서는 안된다.

이에, 본 연구는 ST307과 non-ST307의 분자 역학 조사와항균제 내성을 비교 분석함으로써, 주요 클론인 ST307의 확산과 non-ST307의 발달을 예방하기 위한 적절한 감염관리와 효과적인 감시체계가 필요할 것으로 사료된다.

요약

Go to

Carbapenem 내성 Klebsiella pneumoniae (Carbapenem-resistant K. pneumonia, CRKP)는 전 세계적인 공중 보건문제로 대두되고 있다. 최근 Klebsiella pneumoniae carbapenemase-2 (KPC-2) 생성 sequence type (ST)307은CRKP의 주요 클론으로 확인되었으며, 국내에서 ST307의확산이 보고되었다. 본 연구에서는 2020년 3월부터 2021년12월까지 대전지역의 3차 병원에서 분리된 CRKP 50균주를 대상으로, 분자 특성과 항균제 내성 양상을 조사하였다. 역학적 관계는 multilocus sequence typing (MLST)를 통해분석하였고, 항균제 감수성 검사는 디스크 확산법을 통해 확인하였다. PCR과 DNA 염기서열분석은 carbapenemase 유전자 확인을 위해 수행하였다. CRKP감염은 남성과 60세 이상의 환자에서 훨씬 더 빈번하게 확인되었다. CRKP 50균주중 46균주(92.0%)는 다제내성(MDR)을 보였고, 44균주(88.0%)는 carbapenemase-producing K. pneumoniae (CPKP)로 확인되었다. 주요 carbapenemase 유형은 KPC-2 (36균주, 72.0%)였으며, New Delhi metallo-enzyme-1 (NDM-1)과NDM-5는 각각 7균주(14.0%)와 1균주(2.0%)에서 확인되었다. 특히, KPC-2 생성 K. pneumoniae의 88.9% (32/36)가ST307에 속한 반면, NDM-1,-5 생성 K. pneumoniae의87.5% (7/8)가 non-ST307에 속한 것을 확인하였다. 이러한결과는 ST307의 확산 뿐만 아니라 non-ST307의 발달을 예방하기 위한 적절한 감염관리와 효과적인 감시체계가 필요하다고 사료된다.

Acknowledgments

Go to

This paper was supported by academic research fund offered from Daejeon Institute of Science and Technology in 2023 (DST2023-13).

Conflict of Interest

Go to

The authors have no financial conflicts of interest to declare.

References

Go to
  1. MacKenzie FM, Forbes KJ, Dorai-John T, Amyes SG, Gould IM. 1997. Emergence of a carbapenem-resistant Klebsiella pneumoniae. Lancet 350: 783.
    Pubmed CrossRef
  2. Deshpande LM, Jones RN, Fritsche TR, Sader HS. 2006. Occurrence and characterization of carbapenemase-producing Enterobacteriaceae: report from the SENTRY Antimicrobial Surveillance Program (2000-2004). Microb. Drug Resist. 12: 223-230.
    Pubmed CrossRef
  3. Zheng B, Dai Y, Liu Y, Shi W, Dai E, Han Y, et al. 2017. Molecular epidemiology and risk factors of carbapenem-resistant Klebsiella pneumoniae infections in eastern China. Front. Microbiol. 8: 1061.
    Pubmed KoreaMed CrossRef
  4. Tacconelli E, Carrara E, Savoldi A, Harbarth S, Mendelson M, Monnet DL, et al. 2018. Discovery, research, and development of new antibiotics: the WHO priority list of antibiotic-resistant bacteria and tuberculosis. Lancet Infect. Dis. 18: 318-327.
  5. Hu Y, Liu C, Shen Z, Zhou H, Cao J, Chen S, et al. 2020. Prevalence, risk factors and molecular epidemiology of carbapenem-resistant Klebsiella pneumoniae in patients from Zhejiang, China, 2008-2018. Emerg. Microbes Infect. 9: 1771-1779.
    Pubmed KoreaMed CrossRef
  6. Nordmann P, Cuzon G, Naas T. 2009. The real threat of Klebsiella pneumoniae carbapenemase-producing bacteria. Lancet Infect. Dis. 9: 228-236.
    Pubmed CrossRef
  7. Kim SH, Kim GR, Jeong J, Kim S, Shin JH. 2020. Prevalence and characteristics of carbapenemase-producing Enterobacteriaceae in three tertiary-care Korean University hospitals between 2017 and 2018. Jpn. J. Infect. Dis. 73: 431-436.
    Pubmed CrossRef
  8. Kim JH, Cho YY, Choi JY, Wi YM, Ko KS. 2021. Two distinct genotypes of KPC-2-producing Klebsiella pneumoniae isolates from South Korea. Antibiotics 10: 911.
    Pubmed KoreaMed CrossRef
  9. Rhee JY, Park YK, Shin JY, Choi JY, Lee MY, Peck KR, et al. 2010. KPC-producing extreme drug-resistant Klebsiella pneumoniae isolate from a patient with diabetes mellitus and chronic renal failure on hemodialysis in South Korea. Antimicrob. Agents Chemother. 54: 2278-2279.
    Pubmed KoreaMed CrossRef
  10. Yoon EJ, Yang JW, Kim JO, Lee H, Lee KJ, Jeong SH. 2018. Carbapenemase-producing Enterobacteriaceae in South Korea: a report from the National Laboratory Surveillance System. Future Microbiol. 13: 771-783.
    Pubmed CrossRef
  11. Cho HH. 2022. Epidemiological study of KPC-2 producing Klesiella pneumoniae isolated in Daejeon during a 4-year period. Korean J. Clin. Lab. Sci. 54: 265-272.
    CrossRef
  12. Cho YY, Kim JH, Kim H, Lee J, Im SJ, Ko KS. 2022. Comparison of virulence between two main clones (ST11 and ST307) of Klebsiella pneumoniae isolates from South Korea. Microorganisms 10: 1827.
    Pubmed KoreaMed CrossRef
  13. Villa L, Feudi C, Fortini D, Brisse S, Passet V, Bonura C, et al. 2017. Diversity, virulence, and antimicrobial resistance of the KPCproducing Klebsiella pneumoniae ST307 clone. Microb. Genom. 3: e000110.
    Pubmed KoreaMed CrossRef
  14. Clinical and Laboratory Standards Institute. 2012. Performance standards for antimicrobial susceptibility testing; twentieth informational supplement, M100-S22. Wayne, Pennsylvania.
  15. Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, et al. 2012. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 18: 268-281.
    Pubmed CrossRef
  16. Poirel L, Walsh TR, Cuvillier V, Nordmann P. 2011. Multiplex PCR for detection of acquired carbapenemase genes. Diagn. Microbiol. Infect. Dis. 70: 119-123.
    Pubmed CrossRef
  17. Peirano G, Chen L, Kreiswirth BN, Pitout JDD. 2020. Emerging antimicrobial-resistant high-risk Klebsiella pneumoniae clones ST307 and ST147. Antimicrob. Agents Chemother. 64: e01148-20.
    Pubmed KoreaMed CrossRef
  18. Baker S, Thomson N, Weill FX, Holt KE. 2018. Genomic insights into the emergence and spread of antimicrobial-resistant bacterial pathogens. Science 360: 733-738.
    Pubmed KoreaMed CrossRef
  19. Chang YY, Chuang YC, Siu LK, Wu TL, Lin JC, Lu PL, et al. 2015. Clinical features of patients with carbapenem nonsusceptible Klebsiella pneumoniae and Escherichia coli in intensive care units: a nationwide multicenter study in Taiwan. J. Microbiol. Immunol. Infect. 48: 219-225.
    Pubmed CrossRef
  20. Park JJ, Seo YB, Lee J, Eom JS, Song W, Choi YK, et al. 2020. Positivity of carbapenemase-producing Enterobacteriaceae in patients following exposure within long-term care facilities in Seoul, Korea. J. Korean Med. Sci. 35: e303.
    Pubmed KoreaMed CrossRef
  21. Yoon EJ, Kim JO, Kim D, Lee H, Yang JW, Lee KJ, et al. 2018. Klebsiella pneumoniae Carbapenemase Producers in South Korea between 2013 and 2015. Front. Microbiol. 9: 56.
    Pubmed KoreaMed CrossRef
  22. Habeeb MA, Haque A, Nematzadeh S, Iversen A, Giske CG. 2013. High prevalence of 16S rRNA methylase RmtB among CTX-M extended-spectrum β-lactamase-producing Klebsiella pneumoniae from Islamabad, Pakistan. Int. J. Antimicrob. Agents 41: 524-526.
    Pubmed CrossRef
  23. Fu B, Yin D, Sun C, Shen Y, Liu D, Bai R, et al. 2022. Clonal and horizontal transmission of blaNDM among Klebsiella pneumoniae in children's intensive care units. Microbiol. Spectr. 10: e0157421.
    Pubmed KoreaMed CrossRef
  24. Wu W, Feng Y, Tang G, Qiao F, McNally A, Zong Z. 2019. NDM metallo-β-lactamases and their bacterial producers in health care settings. Clin. Microbiol. Rev. 32: e00115-18.
    Pubmed KoreaMed CrossRef
  25. Guo H, Wu Y, Li L, Wang J, Xu J, He F. 2023. Global emergence of carbapenem-resistant Klebsiella pneumoniae co-carrying multiple carbapenemases. Comput. Struct. Biotechnol. J. 21: 3557-3563.
    Pubmed KoreaMed CrossRef
  26. Shao C, Wang W, Liu S, Zhang Z, Jiang M, Zhang F. 2021. Molecular epidemiology and drug resistant mechanism of carbapenemresistant Klebsiella pneumoniae in elderly patients with lower respiratory tract infection. Front. Public Health 9: 669173.
    Pubmed KoreaMed CrossRef
  27. Elmanakhly AR, Bendary MM, Safwat NA, Awad EA, Alhomrani M, Alamri AS, et al. 2022. Carbapenem-resistant Klebsiella pneumoniae: diversity, virulence, and antimicrobial resistance. Infect. Drug Resist. 15: 6177-6187.
    Pubmed KoreaMed CrossRef
  28. Jeong SH, Kim HS, Kim JS, Shin DH, Kim HS, Park MJ, et al. 2016. Prevalence and molecular characteristics of carbapenemaseproducing Enterobacteriaceae From five hospitals in Korea. Ann. Lab. Med. 36: 529-535.
    Pubmed KoreaMed CrossRef
  29. Park Y, Choi Q, Kwon GC, Koo SH. 2020. Molecular epidemiology and mechanisms of tigecycline resistance in carbapenemresistant Klebsiella pneumoniae isolates. J. Clin. Lab Anal. 34: e23506.
    Pubmed KoreaMed CrossRef
  30. Yigit H, Queenan AM, Anderson GJ, Domenech-Sanchez A, Biddle JW, Steward CD, et al. 2001. Novel carbapenem-hydrolyzing beta-lactamase, KPC-1, from a carbapenem-resistant strain of Klebsiella pneumoniae. Antimicrob. Agents Chemother. 45: 1151-1161.
    Pubmed KoreaMed CrossRef

Article Tools

Starts of Metrics

Share this article on :

Most Searched Keywords ?

What is Most Searched Keywords?

  • It is most registrated keyword in articles at this journal during for 2 years.