Contact us
닫기
Article Search
닫기

Microbiology and Biotechnology Letters

Research Article(보문)

View PDF

Molecular and Cellular Microbiology  |  Host-Microbe Interaction and Pathogenesis

Microbiol. Biotechnol. Lett. 2023; 51(4): 507-516

https://doi.org/10.48022/mbl.2307.07007

Received: July 18, 2023; Revised: September 8, 2023; Accepted: September 12, 2023

Emodin Attenuates Inflammasome Activation Induced by Helicobacter pylori Infection through Inhibition of VacA Translocation

Thach Phan Van1,2 and Anh Duy Do1*

1Department of Biotechnology, NTT Hi-Tech Institute, Nguyen Tat Thanh University, Ho Chi Minh City, 700000, Vietnam
2Department of Life Science, College of Natural Sciences, Hanyang University, Seoul 04763, Republic of Korea

Correspondence to :
Anh Duy Do,       daduy@ntt.edu.vn

Abstract

Go to

Eradication of Helicobacter pylori infection is an essential strategy to decrease the risk of developing gastric cancer. However, the standard triple therapy has negative aspects associated with side effects and the emergence of antibiotic resistance. Therefore, alternative therapies are required to enhance the management of H. pylori infection effectively. In this study we examined the effect of emodin on the amelioration of inflammatory response due to H. pylori infection. Our results indicated that emodin treatment effectively decreased the expression of virulence genes, including sabA, vacA, cagL, cagA, sabA, and suppressed the adhesion ability of H. pylori to AGS cells. Emodin has been shown inhibitory effects on the inflammasome pathway through reductions in VacA translocation, lowering ROS stress, cleaved Caspase-1, NLRP3, and cleaved Gasdermin D levels, thereby lowered pyroptosis in infected cells. In summary, our study demonstrated that emodin has the ability to attenuate inflammation caused by H. pylori by modulating virulence gene expression and decreasing VacA translocation. Further study is required to evaluate the therapeutic efficacy of emodin in treating H. pylori infection and better understand the underlying mechanisms.

Keywords: Helicobacter pylori, emodin, inflammasome, gasdermin D, pyroptosis

Graphical Abstract


Introduction

Go to

Helicobacter pylori infection is a prevalent gastrointestinal infection that specifically targets the lining of the stomach [1]. The primary transmission for this pathogenic bacterium is direct contact between individuals, often occurring during childhood [2]. Furthermore, transmission can occur through the ingestion of contaminated food or water [2]. While many infected individuals may not show symptoms, typical symptoms of the infection include abdominal pain, nausea, bloating, and unintentional weight loss [3]. It has been suggested that H. pylori infection triggers the activation of the inflammasome, which is a crucial component of the immune system through bacterial factors like Vacuolating cytotoxin A (VacA) and cag pathogenicity island (cagPAI) [4]. The activation of the inflammasome induces the synthesis of pro-inflammatory cytokines, thereby facilitating the recruitment of leucocytes to the infection areas [5]. Acute inflammation is essential for combating infections, but chronic inflammation can cause tissue damage and elevate the susceptibility to gastric diseases [6]. Chronic infection has the potential to give rise to enduring inflammation, thereby increasing the risk of developing gastritis, peptic ulcers, and ultimately gastric cancer [7].

The conventional therapy for H. pylori infection involves a conjunction of antibiotics (such as amoxicillin, clarithromycin, metronidazole, or tetracycline) and acidreducing medications [8]. The significant concern about the emergence of antibiotic resistance in H. pylori is attributed to various factors, including the excessive and inappropriate utilization of antibiotics, incomplete treatment, and the widespread transmission of the bacteria. The presence of antibiotic-resistant strains of has the potential to result in treatment ineffectiveness, extended durations of infections, escalated medical expenses, and a higher incidence of complications [9]. Herbal remedies are being increasingly investigated as an alternative therapeutic strategy for the elimination of H. pylorirelated diseases [10]. Certain herbal extracts have demonstrated potential efficacy in treating H. pylori. The acetone extract derived from the flowers of Acacia nilotica has been shown to suppress the urease activity, thereby reducing the viability of H. pylori in the gastric lumen [11]. Garlic extracts including oil and aqueous, have been shown to disrupt the bacterial cell wall integrity of H. pylori [12]. Additionally, Korean propolis has been shown a significant antioxidant effects through scavenging reactive oxygen species (ROS), and reduced inflammation triggered by H. pylori infection [13]. Furthermore, baicalin and baicalein have been shown to reduce the inflammation caused by VacA toxin protein both in vitro and in vivo [14]. Furthermore, previous clinical studies has shown that licorice extract and curcumin possess the ability to inhibit the proliferation of H. pylori in gastric mucosa and alleviate gastric inflammation [15, 16].

Emodin, an anthraquinone compound, has been found in various herbal plant species such as Rheum officinale (Chinese rhubarb), Polygonum cuspidatum (Japanese knotweed), Cassia obtusifolia (sicklepod), and Aloe vera [17, 18]. Previous studies have provided evidence of the antibacterial properties of emodin against various pathogenic bacteria [19, 20]. Emodin has been shown to interfere with bacterial cell viability like disrupting the cell membranes, inhibiting functional enzymes, and interfering with bacterial DNA replication in both methicillin-resistant S. aureus (MRSA) and multidrugresistant E. coli strains [21]. The inhibitory effects of emodin on the growth of H. pylori in vitro have been demonstrated, however, the underlying mechanisms remain unclear [22]. This study aimed to examine the therapeutic effectiveness of emodin in the treatment of H. pylori infection and to understand the molecular mechanisms responsible for its inhibitory effects.

Material and Methods

Go to

Bacterial strains and cell lines

H. pylori (ATCC 26695) was cultivated on TSA culture medium (Himedia, India), supplemented with 5% sheep blood. The bacterial culture was incubated in a microaerophilic environment using MGC anaerobic GasPak system (Mitsubishi, Japan) at 37℃ for 48 h) [23]. The AGS cell line (ATCC CLR1739) was cultivated in RPMI 1640 culture medium (Gibco-Life Technologies, USA), supplemented with 10% fetal bovine serum (FBS), 100 μg/ml streptomycin, and 100 U/ml penicillin. The cells culture were maintained at 37℃ and 5% CO2 [23].

Antimicrobial activity of emodin to H. pylori

Aloe emodin (CAS number 481-72-1, Sigma-Aldrich, USA) was applied to evaluate the antimicrobial efficacy against H. pylori. Briefly, H. pylori suspension (1 × 106 CFU/ml) was resupended in RPMI contain emodin at various concentrations 8 to 512 μM, then incubated at 37℃ for 6 h. The group that received only the RMPI culture medium was designated as the untreated group. H. pylori viability was assessed using serial dilutions and culturing on TSA supplemented with 5% sheep blood for 48 h, followed by colony counting.

Effect of emodin on the growth of AGS cells

AGS cells were cultured at 5 × 104 cells / well in 24-well plates at 37℃, 5% CO2 for 6 h. Subsequently, varying concentrations of emodin ranging from 8 to 1024 μM dissolved in 0.1% DMSO were introduced to the cells and incubated at 37℃, 5% CO2 for 18 h. The group that received only the RMPI culture medium was designated as the untreated group. To determine cell viability, the trypan blue exclusion test was used, where results represent the percentage of cells that survive treatment. Equal volumes of 10 μl cell suspension in PBS (pH 7.4) and trypan blue (Thermo Fisher Scientific, Inc., USA) were mixed. Subsequently, stained (dead) and unstained (surviving) cells were counted using a hemocytometer [14].

Emodin treatments of H. pylori

H. pylori colonies were collected from TSA plates and suspended at a concentration of 5 × 106 CFU/ml in RPMI culture medium supplemented with emodin at concentrations ranging from 16 to 128 μM. The suspensions were subjected to incubation at 37℃ for 2 h. After incubation, H. pylori cells were collected for the isolation of mRNA. Furthermore, emodin-treated H. pylori were subsequently infected with AGS cells.

Real-time RT-PCR

The total mRNA of H. pylori was collected using the total Genomic DNA/RNA Extraction Kit (TBR Ltd., Vietnam). Reverse transcription was then conducted using the SensiFASTTM cDNA Synthesis Kit (TBR Ltd., Vietnam), following the instructions provided by the manufacturer. The cDNA was obtained to analyze gene expression using the QuantStudio 3 system (Applied Biosystems, USA) and quantified by comparative ΔΔCt methodology. The mRNA levels of 16S rRNA derived from H. pylori were assigned as an internal control in order to verify sample loading and evaluate the integrity of mRNA. The results were quantified as fold-change values relative to the untreated group. Primers used in this study were included in Table 1.

Table 1 . Primers used in this study.

Primer nameSequence (5’-3’)
Mus HP16S-FGTGTGGGAGAGGTAGGTGGA
Mus HP16S-RTGCGTTAGCTGCATTACTGG
VacA-FCTGCAGAAGGGAGGAAAG
VacA-RGGCGCCATCATAAAGAGAAAT T
CagA-FATAATGATAAATTAGACAACTTGAGCGA
CagA-RTTAGAATAATCAACAAACATCACGCCAT
BabA-FTGCTCAGGGCAAGGGAATAA
BabA-RATCGTGGTGGTTACGCTTTTG
SabA-FGGTGTGCTGCAACAGACTCAA
SabA-RCATAAGCTGTTGCGCCAAATT
CagL-FAAAACACTCGTGAAAAATACCATATC
CagL-RTCGCTTCAAAATTGGCTTTC


Effect of emodin on the adhesion ability of H. pylori to AGS cells

AGS cells were cultured at 5 × 104 cells / well in 24-well plates at 37℃, 5% CO2 for 18 h. In the co-treatment groups, H. pylori was co-cultured with AGS cells at a multiplicity of infection (MOI) of 100, followed by the addition of emodin at concentrations ranging from 16 to 128 μM for 6 h. In the H. pylori pre-treatment groups, H. pylori was subjected to pretreatment with emodin at concentrations ranging from 16 to 128 μM in RPMI for 2 h. Subsequently, the emodin pre-treated H. pylori were collected by centrifuge and then infected AGS cells at a MOI of 100 for 6 h. In the AGS pre-treatment groups, AGS cells were pre-treated with emodin at concentrations of 16 to 128 μM in RPMI for 2 h. The emodin was then removed. The emodin pre-treated AGS cells was then infected by H. pylori at a MOI of 100 for 6 h. In the post-treatment groups, AGS cells were infected with H. pylori at a MOI of 100 for 6 h. Following infection, AGS cells were subjected to three PBS washes and then exposed to emodin at concentrations ranging from 16 to 128 μM for 2 h. The H. pylori-infected AGS cells were then rinsed twice using PBS, collected by using trypsin, and resuspended in RPMI culture medium. The adhesion ability of H. pylori to AGS cells was assessed by culturing diluted infected cells on TSA supplemented with 5% sheep blood for 48 h. The quantification of H. pyloriassociated with AGS cells was performed through manual colony counting.

ELISA measurement of IL-1β and IL-18 levels

The the cell-free supernatants (CFSs) derived from the H. pylori-infected AGS cells were collected for the quantification of IL-1β and IL-18 level, using human IL-1β ELISA ReadySET-Go!® kits and human IL-18 ELISA ReadySET-Go!® kits, respectively, following the manufacturer's instructions.

Evaluation of superoxide dismutase (SOD) and catalase activities

The H. pylori-infected AGS cells was lysed to measure SOD and catalase activity using assay kits (Cayman Chemical, Inc., USA), following the instructions provided by the manufacturer. The results were quantified as fold-change relative to the infection group.

Western bloting analysis

H. pylori-infected AGS cells were lysed using ice-cold RIPA buffer. The protein samples, with a quantity of 40 μg, were subjected to separation using SDS-PAGE electrophoresis and subsequently transferred onto an Immobilon-E polyvinylidene fluoride (PVDF) membrane. Subsequently, the membrane was subjected to an overnight blocking at 4℃, using EveryBlot blocking buffer (Biorad, USA). Primary antibodies (anti-VacA, cytochrome c, caspase-1, NLRP-3, Cleaved Gasdermin D, NF-κB-p65, GAPDH) were diluted in blocking buffer and applied to the membrane, then placed in 4℃ for 18 h. The primary antibodies were then removed, wash by TBST buffer in twice, and then exposed with secondary antibodies (HRP goat anti-rabbit IgG or goat antimouse IgG) for 1−2 h. Following a TBST wash in triplicate, the blots presence in the membrane were detected using the ECL-Western blotting system.

Statistical analysis

Data were analyzed using SAS 9.4 software (SAS, Inc., USA). Statistical significance was assessed between groups using Student’s t test and Dunnett. Results were presented as the mean ± standard error of the mean. p < 0.05 was considered to indicate statistical significance.

Results and Discussion

Go to

Effect of emodin at difference concentration on H. pylori and AGS cells viability

The cytotoxicity of emodin against H. pylori was examined in this study as a primary investigation. H. pylori strains were cultivated in RPMI medium containing varying concentrations of emodin (8−512 μM). The findings demonstrated that H. pylori viability was significantly reduced after a 6-hour incubation with 256 μM emodin or higher concentration (Fig. 1A). Our result agreed with the previous study indicating th inhibitory effect of emodin on the growth of H. pylori in a dosedependent manner [22]. In addition, the AGS cells viability decreased when exposed to emodin at a concentration of 512 μM (Fig. 1B). To investigate the effect of emodin on the treatment of H. pylori infection, subinhibitory concentrations of emodin were used in subsequent experiments with H. pylori and AGS cells.

Figure 1.Effect of emodin at difference concentrations on the H. pylori (A) and AGS cell (B) viability after 6 h of cultivation. Data are presented as the means of triplicate analysis ± standard deviation. * Indicates the significant difference compare to the untreated group. The statistical analysis was conducted using ANOVA followed by Dunnett's test (p<0.05).

Emodin downregulated the virulence gene expression in H. pylori

H. pylori pathogenesis involves various mechanisms and virulence factors, including the outer membrane proteins SabA and BabA, as well as the virulence protein VacA, CagL, and CagA which play a significant role within the infection [24]. Down-regulation of virulence gene expression has been proven as an effective strategy to fight against H. pylori infection [14]. Syzygium aromaticum L. extract has been shown to decreased cagA and vacA expression in H. pylori multidrugresistant strain, thereby reduced the inflammation in infected cells [25]. We therefore examined the effects of emodin on the virulence gene expression in H. pylori. Our results revealed a reduction in mRNA levels of sabA (Fig. 2A), which is associated with bacterial adhesion. Additionally, a dose-dependent decrease in mRNA levels of vacA, cagL, and cagA was observed (Fig. 2B). Previous study also demonstrated that emodin has the ability to suppress the expression of toxin α in S. aureus, thereby reducing the ability to cause pneumonia in mice [26]. These findings indicated that emodin might interfere with H. pylori virulence factors at the transcriptional level, indicating its potential as a therapeutic agent for treating H. pylori-related diseases.

Figure 2.Effect of emodin difference concentrations on the adhesin gene expression (A) and virulence gene expression (B) in H. pylori. Data are presented as the means of triplicate analysis ± standard deviation. * Indicates the significant difference compare to the untreated group. The statistical analysis was conducted using ANOVA followed by Dunnett's test (p < 0.05).

H. pylori adhesion ability to host cells is inhibited by emodin

H. pylori adheres to gastric epithelial cells primarily through the interaction of bacterial adhesins with host cell surface receptors [27, 28]. Outer membrane proteins are crucial in the initial stages of infection. BabA specifically recognizes the Lewis b antigens (Leb), while SabA binds to the sialyl-Lewis (Lex) antigens, present in the gastric epithelial cell surface, thereby promoting H. pylori infection [24, 28]. Given the downregulation of sabA expression by emodin, the subsequent investigation aimed to determine whether pretreatment with emodin might affect the adhesion ability of H. pylori to AGS cells. Moreover, to further investigate whether emodin's target was H. pylori or AGS cells, four distinct experimental was established, including co-treatment, H. pylori pre-treatment, AGS cell pre-treatment, and post-treatment (Fig. 3A). In both the co-treatment and H. pylori pre-treatment groups, a dose-dependent decreased in the adhesion ability of H. pylori to AGS cells was observed (Fig. 3B and C). However, there were no significant decrease in H. pylori load was observed in emodin-pretreated AGS cells and in post-treatment groups (Fig. 3D and E). These findings suggested that emodin might target the reduction of virulence gene expression in H. pylori, thereby reducing the infection.

Figure 3.Effect of emodin on the adhesion ability of H. pylori to AGS cells under various treatment conditions. The schematic diagram of experimental (A). The adhesion of H. pylori to the AGS cells in the co-treatment (B), H. pylori pre-treatment (C), AGS cells pre-treatment (D), and post-treatment (D). * Indicates the significant difference compare to the untreated group. The statistical analysis was conducted using ANOVA followed by Dunnett's test (p<0.05).

Emodin ameliorates H. pylori-induced inflammation respond in infected AGS cells

H. pylori infection has been indicated induces inflammasome activation, which contributes to the immune response and inflammation associated with the infection [4]. H. pylori assemble the T4SS to deliver CagA protein into host cells, triggering the expression of IL-1β and IL-18 via NF-κB pathway [4]. To further investigate the mechanism by which emodin reduces H. pylori pathogenicity to host cells through down-regulated virulence gene expression, the CFSs derived from H. pylori pretreatment groups was collected and conducted proinflammatory cytokine analysis. Our results indicated a consistent decrease in the IL-1β and IL-18 levels in the infected-AGS cells, which aligns with the observed decrease in adhesion ability (Fig. 3B and C) and the cagA expression (Fig. 2B). These findings suggested that emodin has the potential to regulate inflammatory responses caused by H. pylori by downregulation the virulence factors at transcriptional levels.

Emodin ameliorates H. pylori-induced oxidative stress in infected AGS cells

VacA is a protein toxin synthesis by H. pylori that is internalized into gastric epithelial cells through endocytosis. VacA internalization targets and disrupts the integrity of the mitochondrial cellular membrane, triggers oxidative stress in host cells, causing the expression of reactive oxygen species (ROS) [4]. Superoxide dismutase (SOD) and catalase are essential for the detoxification of ROS in order to maintain cellular homeostasis [29]. The data in Fig. 4B, C indicated that H. pylori infection led to reduce the SOD and catalase activities in infected AGS cells. However, pre-treatment of H. pylori with emodin effectively restores the suppressed enzymatic activities induced by the infection, along with the lower mRNA level of vacA caused by emodin treatment (Fig. 4B and C). Our results agreed with previous study indicated that several natural compounds such as Aegle marmelos extract, Callicarpa nudiflora extract, and curcumin have been shown to effectively reduce oxidative stress caused by H. pylori infection [30−32]. Thus, emodin treatment not only decreased the adhesion ability of H. pylori, but also provided protection against oxidative stress in infected cells.

Figure 4.Effect of emodin-pretreated H. pylori on the expression of IL-1β and IL-18 (A), cellular SOD (B) and catalase activity (C) in the infected AGS cells. Data are presented as the means of triplicate analysis ± standard deviation. * Indicates the significant difference compare to the untreated group. The statistical analysis was conducted using ANOVA followed by Dunnett's test (p<0.05).

Effects of emodin on H. pylori-induced cellular response in infected AGS cells

H. pylori infection might induce the production of ROS, which in turn activates NLRP3. This activation leads to the recruitment of Apoptosis-associated specklike protein containing a CARD (ASC) and the subsequent initiation of inflammasome complex assembly. Then, caspase-1 is activated, causing the cleavage of gasdermin D (GSDMD) convert pro-inflammatory cytokines, specifically pro-IL-1β and pro-IL-18 into active forms. The GSDMD cleavage results in the pores formation within the cellular membrane, leading to intracellular leakage and the release of IL-1β and IL-18 [4]. Our data demonstrated that emodin pretreatment effectively suppresses the mRNA levels of the vacA in H. pylori (Fig. 2B), while also reducing the adhesion capacity of H. pylori to AGS cells (Fig. 3B and C). Therefore, we further investigated whether emodin could rescue AGS cells from inflammation caused by H. pylori infection. The results in Fig. 5 shown that emodin pretreatment of H. pylori led to a lowered translocation of VacA into the infected cells, which correlated with the suppression of vacA gene expression. Furthermore, the lowering of VacA translocation is associated with a reduction in cytochrome c release (Fig. 5), suggesting a possible inhibition of apoptotic pathways. The expression of NF-κB-p65 was suppressed in the same pattern (Fig. 5). Additionally, emodin pretreatment of H. pylori led to reduced cleaved Caspase-1 and NLRP3 levels (Fig. 5), which are key components of the inflammasome pathway, in a VacA translocation-dependent manner. The decrease in cleaved Caspase-1 was along with a reduction in cleaved Gasdermin D levels (Fig. 5), which is essential for the assembly of oligomerization pores associated with pyroptosis. Moreover, the administration of emodin has been shown to reduce the release of lactate dehydrogenase (LDH) (Fig. 4B), suggesting its potential to regulate cellular responses related to inflammasome activation in H. pylori infection. Emodin has been shown to reduce inflammasomes in HT-22 hippocampal neurons induced by lipopolysaccharide derived from Gram-negative bacteria [33]. This is a positive result showing that emodin has potential in treating bacterial infection. However, the gastric lumen is a complex environment, including gastric motility, concentrated acid, and digestive enzyme activity [34]. Therefore, gastric simulation models are required for dissect and study the effectiveness of emodin to further apply to in vivo models and clinical trials in the future.

Figure 5.Effect of emodin-pretreated H. pylori on the VacA translocation, expression of NF-κB-p65, cytochrome c, cleaved caspase-1, NLP3, and cleaved gasdermin D in the infected AGS cells. Total proteins were isolated from cell lysates and then subjected to Western blot analysis. Representative Western blotting images were presented.

In summary, the possible mechanism of emodin against H. pylori infection is shown in Fig. 6. During infection, H. pylori expresses adhesion factors SabA and BabA to enhance its adherence to the host cells. Additionally, VacA is translocated into host cells, leading to mitochondrial intergrity disruption, causing the expression of ROS, and subsequent activation of NLRP3 and Caspase-1, then activating inflammasome. The presence of emodin might inhibit the sabA expression, thereby reducing the adhesion ability of H. pylori to the epithelial cells. Moreover, emodin suppresses the mRNA levels of cagA, resulting in reduced synthesis of pro-inflammatory cytokines in the infected cells. On the other hand, emodin also suppressed the vacA expression, thereby lowering the translocation of VacA into the epithelial cells. As a result, this led to restore of the enzymatic activities of SOD and catalase, and decreased activation of NLRP3 and Caspase-1, thereby reducing inflammasome response in epithelial cells.

Figure 6.The possible pathways of emodin against H. pylori infection (for further details see in the conclusion). Lex, Lewis x antigen; Leb, Lewis b antigen; T4SS, type IV secretion system; GSDMD, gasdermin D; ASC, apoptosis-associated speck-like protein; NLRP3, NLR family pyrin domain containing 3; LDH, lactate dehydrogenase; NF-κB, Nuclear factor kappa-light-chain-enhancer of activated B. The figure was created with BioRender.com, License number MO25M6FJ98.

List of Abbreviations

Go to

AGS cell: Human gastric adenocarcinoma cell line

ASC: Apoptosis-associated speck-like protein containing a CARD

BabA: Blood group antigen binding adhesin

CagA: cytotoxin-associated gene A

cagPAI: cag pathogenicity island

GSDMD: Gasdermin D

LDH: Lactate dehydrogenase

NF-κB: Nuclear factor kappa-light-chain-enhancer of activated B

NLRP3: NLR family pyrin domain containing 3

ROS: Reactive oxygen species

SabA: Sialic acid-binding adhesin

SOD: Superoxide Dismutase

VacA: Vacuolating cytotoxin A

Authors Contributions

Go to

ADD designed this study; TPV performed experiments; ADD and TPV wrote the paper. All authors approved this final manuscript. All authors have read and agreed to the published version of the manuscript.

Acknowledgments

Go to

The authors are especially grateful to Nguyen Tat Thanh University for providing all the resources needed for this study.

References

Go to
  1. Borka Balas R, Meliț LE, Mărginean CO. 2022. Worldwide prevalence and risk factors of Helicobacter pylori infection in children. Children 9: 1359.
    Pubmed KoreaMed CrossRef
  2. Stefano K, Marco M, Federica G, Laura B, Barbara B, Gioacchino L, et al. 2018. Helicobacter pylori, transmission routes and recurrence of infection: state of the art. Acta Biomed. 89(Suppl 8): 72.
  3. Öztekin M, Yılmaz B, Ağagündüz D, Capasso R. 2021. Review of Helicobacter pylori infection: clinical features, treatment, and nutritional aspects. Diseases 9: 66.
    Pubmed KoreaMed CrossRef
  4. Kumar S, Dhiman M. 2018. Inflammasome activation and regulation during Helicobacter pylori pathogenesis. Microb. Pathog. 125: 468-474.
    Pubmed CrossRef
  5. Latz E, Xiao TS, Stutz A. 2013. Activation and regulation of the inflammasomes. Nat. Rev. Immunol. 13: 397-411.
    Pubmed KoreaMed CrossRef
  6. Chen L, Deng H, Cui H, Fang J, Zuo Z, Deng J, et al. 2018. Inflammatory responses and inflammation-associated diseases in organs. Oncotarget 9: 7204.
    Pubmed KoreaMed CrossRef
  7. Vogiatzi P, Cassone M, Luzzi I, Lucchetti C, Otvos L Jr, Giordano A. 2007. Helicobacter pylori as a class I carcinogen: physiopathology and management strategies. J. Cell. Biochem. 102: 264-273.
    Pubmed CrossRef
  8. Malfertheiner P, Megraud F, O'Morain C, Bazzoli F, El-Omar E, Graham D, et al. 2007. Current concepts in the management of Helicobacter pylori infection: the Maastricht III consensus report. Gut 56: 772-781.
    Pubmed KoreaMed CrossRef
  9. Tshibangu-Kabamba E, Yamaoka Y. 2021. Helicobacter pylori infection and antibiotic resistance-from biology to clinical implications. Nat. Rev. Gastroenterol. Hepatol. 18: 613-629.
    Pubmed CrossRef
  10. Zou Y, Qian X, Liu X, Song Y, Song C, Wu S, et al. 2020. The effect of antibiotic resistance on Helicobacter pylori eradication efficacy: A systematic review and meta‐analysis. Helicobacter 25: e12714.
    Pubmed CrossRef
  11. Amin M, Anwar F, Naz F, Mehmood T, Saari N. 2013. Anti-Helicobacter pylori and urease inhibition activities of some traditional medicinal plants. Molecules 18: 2135-2149.
    Pubmed KoreaMed CrossRef
  12. Cellini L, Di Campli E, Masulli M, Di Bartolomeo S, Allocati NJFI. 1996. Microbiology M. 1996. Inhibition of Helicobacter pylori by garlic extract (Allium sativum). FEMS Immunol. Med. Microbiol. 13: 273-277.
    Pubmed CrossRef
  13. Song M-Y, Lee D-Y, Kim E-H. 2020. Anti-inflammatory and antioxidative effect of Korean propolis on Helicobacter pyloriinduced gastric damage in vitro. J. Microbiol. 58: 878-885.
    Pubmed CrossRef
  14. Chen ME, Su CH, Yang JS, Lu CC, Hou YC, Wu JB, et al. 2018. Baicalin, Baicalein, and Lactobacillus Rhamnosus JB3 Alleviated Helicobacter pylori infections in vitro and in vivo. J. Food Sci. 83: 3118-3125.
    Pubmed CrossRef
  15. Momeni A, Rahimian G, Kiasi A, Amiri M, Kheiri S. 2014. Effect of licorice versus bismuth on eradication of Helicobacter pylori in patients with peptic ulcer disease. Pharma. Res. 6: 341.
    Pubmed KoreaMed CrossRef
  16. Vetvicka V, Vetvickova J, Fernandez-Botran R. 2016. Effects of curcumin on Helicobacter pylori infection. Ann. Transl. Med. 4: 479.
    Pubmed KoreaMed CrossRef
  17. Wang M, Zhao R, Wang W, Mao X, Yu J. 2012. Lipid regulation effects of Polygoni Multiflori Radix, its processed products and its major substances on steatosis human liver cell line L02. J. Ethnopharmacol. 139: 287-293.
    Pubmed CrossRef
  18. Lee M-H, Kao L, Lin C-C. 2011. Comparison of the antioxidant and transmembrane permeative activities of the different Polygonum cuspidatum extracts in phospholipid-based microemulsions. J. Agric. Food Chem. 59: 9135-9141.
    Pubmed CrossRef
  19. Xiang H, Cao F, Ming D, Zheng Y, Dong X, Zhong X, et al. 2017. Aloe-emodin inhibits Staphylococcus aureus biofilms and extracellular protein production at the initial adhesion stage of biofilm development. Appl. Microbiol. Biotechnol. 101: 6671-6681.
    Pubmed CrossRef
  20. Lee H, Tsai S-J. 1991. Effect of emodin on cooked-food mutagen activation. Food Chem. Toxicol. 29: 765-770.
    Pubmed CrossRef
  21. Duan F, Xin G, Niu H, Huang W. 2017. Chlorinated emodin as a natural antibacterial agent against drug-resistant bacteria through dual influence on bacterial cell membranes and DNA. Sci. Rep. 7: 12721.
    Pubmed KoreaMed CrossRef
  22. Wang H-H, Chung J-G. 1997. Emodin-induced inhibition of growth and DNA damage in the Helicobacter pylori. Curr. Microbiol. 35: 262-266.
    Pubmed CrossRef
  23. Do AD, Su C-H, Hsu Y-M. 2022. Antagonistic activities of Lactobacillus rhamnosus JB3 against Helicobacter pylori infection through lipid raft formation. Front. Immunol. 12: 796177.
    Pubmed KoreaMed CrossRef
  24. Oleastro M, Ménard A. 2013. The role of Helicobacter pylori outer membrane proteins in adherence and pathogenesis. Biology 2: 1110-1134.
    Pubmed KoreaMed CrossRef
  25. El-Shouny WA, Ali SS, Hegazy HM, Abd Elnabi MK, Ali A, Sun J. 2020. Syzygium aromaticum L.: Traditional herbal medicine against cagA and vacA toxin genes-producing drug resistant Helicobacter pylori. J. Trad. Complement. Med. 10: 366-377.
    Pubmed KoreaMed CrossRef
  26. Jiang L, Yi T, Shen Z, Teng Z, Wang J. 2019. Aloe-emodin attenuates Staphylococcus aureus pathogenicity by interfering with the oligomerization of α-toxin. Front. Cell. Infect. Microbiol. 9: 157.
    Pubmed KoreaMed CrossRef
  27. Ilver D, Arnqvist A, Ögren J, Frick I-M, Kersulyte D, Incecik ET, et al. 1998. Helicobacter pylori adhesin binding fucosylated histoblood group antigens revealed by retagging. Science 279: 373-377.
    Pubmed CrossRef
  28. Mahdavi J, Sondén B, Hurtig M, Olfat FO, Forsberg L, Roche N, et al. 2002. Helicobacter pylori SabA adhesin in persistent infection and chronic inflammation. Science 297: 573-578.
    Pubmed KoreaMed CrossRef
  29. Matsumoto H, Silverton S, Debolt K, Shapiro I. 1991. Superoxide dismutase and catalase activities in the growth cartilage: relationship between oxidoreductase activity and chondrocyte maturation. J. Bone Mineral Res. 6: 569-574.
    Pubmed CrossRef
  30. Ramakrishna YG, Savithri K, Kist M, Devaraj SN. 2015. Aegle marmelos fruit extract attenuates Helicobacter pylori Lipopolysaccharide induced oxidative stress in Sprague Dawley rats. BMC Complement. Alter. Med. 15: 1-10.
    Pubmed KoreaMed CrossRef
  31. Li L, Bao B, Chai X, Chen X, Su X, Feng S, et al. 2022. The antiinflammatory effect of callicarpa nudiflora extract on H. Pylori-infected GES-1 cells through the inhibition of ROS/NLRP3/Caspase-1/IL-1β signaling Axis. Can. J. Infect. Dis. Med. Microbiol. 2022: 5469236.
    Pubmed KoreaMed CrossRef
  32. Judaki A, Rahmani A, Feizi J, Asadollahi K, Hafezi Ahmadi MR. 2017. Curcumin in combination with triple therapy regimes ameliorates oxidative stress and histopathologic changes in chronic gastritis-associated Helicobacter pylori infection. Arq. Gastroenterol. 54: 177-182.
    Pubmed CrossRef
  33. Choi HR, Lim H, Lee JH, Park H, Kim HP. 2021. Interruption of Helicobacter pylori-induced NLRP3 inflammasome activation by chalcone derivatives. Biomol. Ther. 29: 410-418.
    Pubmed KoreaMed CrossRef
  34. Van den Abeele J, Rubbens J, Brouwers J, Augustijns P. 2017. The dynamic gastric environment and its impact on drug and formulation behaviour. Eur. J. Pharm. Sci. 96: 207-231.
    Pubmed CrossRef

Article Tools

Starts of Metrics

Share this article on :

Most Searched Keywords ?

What is Most Searched Keywords?

  • It is most registrated keyword in articles at this journal during for 2 years.