Contact us
닫기
Article Search
닫기

Microbiology and Biotechnology Letters

Research Article(보문)

View PDF

Environmental Microbiology  |  Microbial Ecology and Diversity

Microbiol. Biotechnol. Lett. 2023; 51(4): 474-483

https://doi.org/10.48022/mbl.2303.03011

Received: March 28, 2023; Revised: August 11, 2023; Accepted: August 16, 2023

Antibacterial Activity of Streptomyces Strains Isolated from Different Regions of Jordan

Hala Khyami-Horani1*, Amal Al-Aboudi2, Musa Abu Zarga2, Monther Sadder3, and Halima Othman1

1Department of Biological Sciences, School of Science, 2Department of Chemistry, School of Science, 3Department of Horticulture and Crop Science, School of Agriculture, The University of Jordan, Amman 11942, Jordan

Correspondence to :
Hala Khyami-Horani,        horani.hala@gmail.com

Abstract

Go to

Members of the genus Streptomyces produce more than 70% of antibiotics. The rise in antibiotic resistance globally enhanced the search for novel species with the ability to produce new bioactive compounds. This study was initiated to investigate different regions in Jordan for previously uncultured and rare Streptomyces species capable of producing novel antimicrobial compounds especially active against bacteria resistant to antibiotics. A total of 191 Streptomyces strains were isolated from 26 soil samples collected from different geographic regions in Jordan. Isolates were characterized based on colony and cellular morphology as well as using 16S rRNA gene sequencing. These isolates were screened for their ability to produce antibiotics by the perpendicular-cross streak method, and then tested by well diffusion method against tested pathogens. Fifty-four isolates showed potential to produce antimicrobial products especially active against resistant bacteria, 20.1% of the isolates showed inhibitory effect against Staphylococcus aureus, 16.9% against clinical MSSA strains, and 18.0% against MRSA: whereas only 4.2% against Esherichia coli, 3.2% against Klebsiella pneumonia, 2.7% against Pseudomonas aeruginosa, and 10.0% against clinical Candida albicans. Three isolates were selected for further identification due to their antibacterial activity against S. aureus, MRSA, and MSSA. These isolates were identified as follows; Streptomyces aburaviensis DSa3, Streptomyces alboniger SAb7 and Streptomyces misionensis ZAb2, based on cultural, biochemical characteristics and molecular analysis of the 16S rRNA.

Keywords: Streptomyces, Actinomycetes, Actinomycetia, Jordan, soil, antibiotics, antibacterial activity

Introduction

Go to

Streptomyces is a genus of diverse group of filamentous, Gram positive, spore-forming, saprophytic bacteria with high GC content that ranges from 69−73% [1, 2]. They grow as branching hyphal filaments to form a mat of fungus-like mycelium, from which the aerial branches that bear chains of spores emerge [3]. This genus forms an important group of Actinobacteria [4] commonly known as Actinomycetes and belongs to the family Streptomycetaceae. Streptomyces strains represent a group of microorganisms widely distributed in nature. They are abundant in soil, and account for 90% of the soil Actinomycetes [5]. Some species are associated with plants; and are among the most frequent endophytes with antagonistic agents against plant pests [6]. Streptomyces species produce various antagonists against plant disease agents and pests such as bacteria, fungi, and insects. More than 80% of naturally occurring antibiotics have been developed from actinomycetes, and mainly from members of the genus Streptomyces [7]. These organisms are extensively investigated in order to provide new therapeutic agents to combat the global rise of antibiotic resistance among many pathogenic bacteria [8, 9], as well as their capacity to produce antifungal [10, 11] and other biologically active secondary metabolites [12, 13] including antiviral [14] and antitumor metabolites [15, 16], immunosuppressant [17], and plant growth promoting agents [18]. In addition, they produce many commercial antibiotics including neomycin produced from S. fradiae [19], chloramphenicol from S. venezuelae [20], puromycin from S. alboniger [21], Streptomycin from S. grise [22], oleandomycin from S. antibioticus [23], lincomycin from S. lincolnensis [24], tetracycline from S. rimosus and S. aureofaciens [25], daptomycin from S. roseosporus [26], fosfomycin from S. fradiae [27], tunicamycin from S. torulosus (Atta, 2010) [28]. Validamycin, isocoumarins, undecylprodiginine, streptorubin B, pyrrole-2-carboxamide, acetyltryptamine and fervenulin were also reported [29].

The search for novel antibiotics from Streptomyces spp. in environments with extreme conditions and novel ecological systems, is still attracting a lot of attention [7, 13, 30].

Jordanian soils have special and diversified habitats which make them a promising source for new strains of Steptomycetes capable of producing new types of metabolites. Jordan includes four bio-geographical regions including Mediterranean, Iranoturanian, Saharo-arabian and Sudanian-penetration [31].

These regions vary in climate, rainfall, vegetation, and provision which makes them a suitable habitat to a wide range of highly and diversified adapted organisms. The number and species of microorganisms in soil vary according to environmental conditions such as nutrient availability, soil texture, and type of vegetation covers [32, 33].

Presently, little documented work has been carried out on the potential of soil Streptomyces in Jordan to produce antimicrobial compounds [34].

This study thus aimed at isolation of Streptomyces spp. from soils collected from different habitats in Jordan, characterization of the isolates by conventional methods, and examination of their potential to produce antibiotics with specific inhibitory effects against various multiple antibiotic resistant Staphylococcus aureus strains.

Materials and Methods

Go to

Sample Collection

Soil samples were collected from diverse habitats in Jordan, which included agricultural soil, fields preserved areas, forest soils, and the plant rhizospheres from various locations. Samples were collected from fifteen locations in Jordan (Fig. 1). A brief description of collection site was listed in Table 1. The superficial soil layers (3-5 cm) were removed, and the soil samples were taken up to 20 cm depth. The samples were kept in clean plastic bags, closely tied, labeled, and transported to the laboratory in ice cold bucket [35]. The soil samples were dried for 24 h at 30℃, and then sieved prior to use for isolation purpose [36].

Table 1 . Description of soil collection sites.

NumberSiteAbbreviationDescription
1IrbidIRIt is characterized by rolling hills and fertile plains, supporting agricultural activities (Olives and wheat)
2HemmahHEIt features a rugged terrain with rocky hills and valleys. Its includes Mediterranean shrublands and wildflowers.
3AjlounAJA hilly landscapes covered with Mediterranean forests (Oak, pine and wildflowers)
4Um-QaisUQIt is has a rocky terrain supports arid-adapted plants (Thorny shrubs)
5JerashJEFertile plains and rolling hills supporting agricultural activities (Olive groves, vineyards, and orchards)
6MafraqMFIt is part of an arid desert region characterized by vast stretches of sandy and rocky landscapes with hardy desert vegetation (Acacia, desert shrubs, and grasses)
7AmmanAMRolling hills with Mediterranean climate supporting a mix of vegetation (Olives, cypress, and native shrubs)
8ZarqaZAAn arid desert with rocky terrain with sparse vegetation (Desert shrubs, thorny plants, and hardy grasses)
9SaltSAA hilly landscapes supporting Mediterranean forests (Oak and pine trees), olives, grapes, and citrus trees.
10AqabaAQRed sea coastal region with arid desert environment (Desert shrubs, salt-tolerant plants, and acacia trees)
11KerakKARugged mountains with and arid vegetation (Desert shrubs, thorny plants, and xerophytic species)
12Wadi RumWRA vast desert wilderness characterized by towering sandstone cliffs and red sand
13PetraPESandy rock formations providing habitat for hardy desert vegetation (Desert shrubs, small trees, and wildflowers)
14Dead SeaDSLowest point on Earth featuring extreme conditions limiting vegetation to salt-tolerant plants and halophytes
15Jordan ValleyJVFertile plains supporting agricultural activities (Date palm plantations, citrus orchards, and vegetables)


Figure 1.Soil collection sites along main biogeographical regions in Jordan.

Streptomyces isolation

Ten grams of dried soil samples were added to 90 ml sterile distilled water in 250 ml Erlenmeyer flasks. Flasks were shaken on rotary shaker at 200 rpm for 30 min. All samples were diluted (up to 10-4) with sterile distilled water prior to inoculation onto the isolation plates. Isolation of Streptomyces was performed using starch-casein agar (SCA) (soluble starch 10 g/l, casein 1 g/l, agar 15 g/l) [37], and inorganic salt starch agar (soluble starch 10 g/l, K2HPO4 1 g/l, MgSO4·7H2O 1 g/l, NaCl 1 g/l, (NH4)2SO4 2 g/l, CaCO3 2 g/l, trace salt solution 1 ml, agar 20 g/l) (trace salt solution: CuSO4·5H2O 0.64 g/l, FeSO4·7H2O 0.11 g/l, MnCl2·4H2O 0.79 g/l, ZnSO4·7H2O 0.15 g/l) [38]. All isolation media contained cycloheximide at a concentration of 7 μg/ml to minimize fungal contamination [39]. The pH of each medium was adjusted to 7.0−7.2. One ml of soil diluents was thoroughly mixed with about 25 ml of melted desired agar medium at around 45−50℃, then poured in 9 cm Petriplate. After gentle rotation, the plates were incubated at 28.0−30.0℃ for 7−14 days [40]. The typical round, small, opaque, compact, and frequently pigmented colonies were selected. Pure colonies that bear typical Streptomyces morphology were purified by sub-culturing and then stored for further assay.

Primary screening for antimicrobial activity of Streptomyces isolates

Cross streak method. Nutrient agar (NA) (Difco) plates were prepared and inoculated with Streptomyces isolate by a single streak of inoculum in the center of the petri plate. After 5 days of incubation at room temperature, the plates were seeded with test microorganisms by a single streak at a 90° angle to the Streptomyces isolate and incubated at 37℃ for 24 h. The microbial interactions were observed, and the sizes of the inhibition zones were recorded [41].

Test microorganisms included Gram positive bacteria (Staphylococcus aureus ATCC 33862, MRSA ATCC 43300, clinical MSSA), Gram negative bacteria (Escherichia coli ATCC 35218, Escherichia coli ATCC 8739, Pseudomonas aeruginosa ATCC 27853, Klebsiella pneumonia ATCC 13883) and clinical Candida albicans. All clinical isolates were obtained from Department of Microbiology, Medical School and Department of Biological Sciences, Science School, University of Jordan).

Agar well diffusion method. The evaluation of antimicrobial activity was also determined by agar well diffusion method [42]. The agar plate surface was inoculated by spreading the test organism over the entire agar surface and left to dry, and then, a hole with a diameter of 8 mm was punched aseptically with a sterile cork-borer, then about 100 μl of Streptomyces broth supernatant grown for 7 days, was added to each well. The agar plates were incubated at 37℃ for 24 h. The inhibition zones around the wells were measured in millimeters.

Morphological characteristics of active Streptomyces isolates

Streptomyces colonies were characterized morphologically and physiologically following the directions given by the International Streptomyces Project (ISP) [43]. Colony morphology was determined using starch agar plates, incubated in the dark at 28℃ for 14 days, and the morphology of sporophore, color of aerial mycelium, color of the reverse side of the culture, and pigment production were recorded. Cellular morphology was examined by light microscopy (100 x).

Biochemical characterization

Biochemical tests for Streptomyces isolates were carried out by using API 20E® test strips (bioMérieux Inc., USA). API 20E® strips include enzymatic tests for the fermentation or oxidation of sugar (glucose, mannitol, inositol, sorbitol, rhamnose, saccharose, melibiose, amygdalin and arabinose), and nitrate reduction to nitrite or to nitrogen gas. API 20E® strips also test for the enzymatic activity of β-galactosidase, arginine dihydrolase, gelatinase, lysine decarboxylase, ornithine decarboxylase, urease and tryptophan deaminase, in addition to indole production, citrate utilization, H2S production and acetoin production (Voges-Proskauer). API 20E® tests were performed according to the manufacturer’s instructions.

PCR amplification and sequencing of 16S rDNA gene

The isolates which showed strong antibacterial activity were subjected to further evaluation by molecular methods. The extraction of genomic DNA was carried out using Promega genomic DNA Wizard kit with slight modifications. Streptomyces isolates were cultured over solid starch agar medium (10 g/l soluble starch, 1 g/l K2HPO4, 1 g/l MgSO4, 2 g/l (NH4)2SO4, 2 g/l CaCO3, 0.64 mg/l CuSO4·5H2O, 0.11 mg/l FeSO4·7H2O, 0.79 mg/l MnCl2·4H2O, 0.15 mg/l ZnSO4·7H2O and 20 g/l agar, pH of 7.0 ± 0.1). Single colonies were inoculated into starch broth medium (as above) and incubated at room temperature for 36 h, under continuous orbital shaking at 120 rpm. Cells were suspended and collected into microtubes. Total genomic DNA was isolated using Wizard® Genomic DNA Purification Kit (Promega, USA). Eventually the genomic DNA of lysed bacterial cells was precipitated with 0.6 volume of isopropanol and purified using 70 % ethanol.

PCR amplification was performed in 10 μl using Master Mix (Promega), 1 μM for both primers and 5 ng total genomic DNA. Five pairs of species-specific PCR primers (Table 2) were designed based on 16S sequence of the reference genome of Streptomyces coelicolor A3(2) (NC_003888.3) published at Genbank (NCBI, 2020).

Table 2 . Streptomyces 16S specific PCR primers, their sequences and expected amplicon sizes.

Primer pairPrimer namePrimer sequence (5'→3')Expected size (bp)
1Strep_01FAGAGTTTGATCCTGGCTCAG1488
Strep_01RGGCTACCTTGTTACGACTT
2Strep_02FAACACATGCAAGTCGAACG1339
Strep_02RACGGGCGGTGTGTAC
3Strep_03FACAAGCCCTGGAAACGGGGT1074
Strep_03RACGTGTGCAGCCCAAGACA
4Strep_04FAACTCGGAGGAAGGTGGGGAC376
Strep_04RAGGAGGTGATCCAGCCGCA
5Strep_05FCCAGCAGCCGCGGTAATAC285
Strep_05RTACCAGGGTATCTAATCC


Amplified DNA fragments were separated using gel electrophoresis (1% agarose in 1X TAE buffer) along with DNA ladder marker (Fermentas, Germany). Gels were stained with ethidium bromide and visualized under UV light using gel documentation system (Alpha-InnoTec GmbH, Germany).

The different amplicons were amplified in thermocycler (Eppendorf, Germany) using optimized program (5 min at 95℃ followed by 35 cycles of 30 sec at 95℃, 30 sec at 52℃ and 1 min at 72℃, and a final extension of 10 min at 72℃).

PCR products of high yield isolates were purified using PCR purification kit (Promega) according to the manufacturer's instructions.

Results and Discussion

Go to

Many studies concerning the isolation and identification of Streptomyces in Jordan have been conducted. These studies involved isolation and identification of Streptomyces from different regions of Jordan [34, 36, 44−51]. However, the diversity of Streptomyces species and variation of Jordan geographical regions are encouraged for further investigations.

In this work, soil samples were collected from the diverse habitats in Jordan (near plant surface rhizosphere, agricultural soil). A total of 191 isolates were recovered from 15 locations and 26 soil samples. All isolates showed good growth and formed extensively branched substrate mycelia and spores on starch agar plates. Spore chain morphology under light microscopy was observed after 14 days of incubation. These isolates were identified as Streptomyces on the basis of cultural and cellular morphology (Figs. 3 and 4), as well as physiological and biochemical characteristics.

Figure 3.Cultural morphology of Streptomyces isolates

Figure 4.Shape of spore chain under light microscope (100 X).

This finding shows that Jordan soil is a rich source of Streptomyces, as was reported by Saadoun et al. [34] where soil samples were collected from different habitats of northern, eastern, and southern Jordan. The average Streptomycete cell numbers in soil samples was 1.98 × 105 cfu/g from northern soil, 1.53 × 105 cfu/g from southern soil, and 1.45 × 105 cfu/g in soil samples from eastern regions.

Primary screening of antibiotic production

Using Streptomyces to explore new bioactive compounds is needed in order to face the antibiotic resistant pathogenic bacteria. Streptomyces species are profiled to be one of the richest resources of commercially important secondary metabolites, which are used as antibiotics, immunosuppressives [52], antiparasitics [53] and anticancers [54].

A total of 54 different Streptomyces isolates out of the 191 isolates chosen on the basis of colony morphology showed potent in vitro antimicrobial activity against the test organisms. Results of the well diffusion and perpendicular method showed activity against microbial strains; 4.3% of the isolates expressed antibacterial activity against E. coli, 3.2% against K. pneumonia, 2.7% against P. aeruginosa, 10% against C. albicans, 20% against S. aureus, 16.93% against MSSA, and 18% against MRSA (Fig. 5). Saadoun et al. [34], collected soil samples from different habitats in northern, eastern and southern Jordan and 6% of the isolates tested were active against one or more of the tested multi-resistant Gram-negative pathogens.

Figure 5.Percentage of active Streptomyces isolates against test organisms based on perpendicular method.

The screening and isolation of Streptomycetes from soil habitats performed in this work show that these microorganisms have a potential to produce antimicrobial compounds. The results of this work extend support for these findings and suggest Streptomyces isolates were more active against Gram positive bacteria such as Staphylococcus aureus, MRSA and MSSA, than Gram negative bacteria E. coli, P. aeruginosa and K. pneumonia [55, 56]. In addition, Streptomyces isolates showed a significant antimicrobial activity against C. albicans. Difference in sensitivity between Gram-positive and Gramnegative bacteria might result from the structure of cell wall; the outer polysaccharide membrane present in Gram negative bacteria that acts as lipopolysaccharide barrier; is absent in Gram positive bacteria which makes the cell wall more susceptible to attack [55, 56].

Al-Ansari et al. [57] found that marine Streptomyces isolates showed broad spectrum activity, with highest activity against S. aureus. Similarly, Kouadri et al. [50] reported that 89% of marine Streptomyces, isolated from Aqaba Gulf, were able to inhibit S. aureus, while only 25% inhibited P. aeruginosa, and only 17% were active against the yeast C. albicans. Jalal and Hasan [58] isolated two strains of Streptomyces from house garden soil samples with antibacterial activity against E. coli and S. aureus. Furthermore, Meliani et al. [59], isolated 4 halotolerant strains of Streptomyces from sediments; morphological, biochemical examinations plus 16S rRNA gene sequence analysis revealed that the four strains belonged to the genus Streptomyces a; all strains inhibited at least one of the tested human pathogenic bacteria. Whereas marine Streptomyces, isolates from Philippine sediments exhibited antibacterial activity against multidrug-resistant S. aureus, P, aeruginosa, and E. coli [60].

The Streptomyces isolates which exhibited antimicrobial activity against at least three of the test organisms by the perpendicular method, were selected and examined for the activity against test organisms by well diffusion method [61, 62]. Well diffusion method was carried out to screen broth filtrates for their antimicrobial potency. The three stains (DSa3, SAb7 and ZAb2) which possessed the highest activity against Staphylococcus aureus (MRSA, and MSSA) were chosen. The biochemical profiles were generated using API 20E® test strips bioMérieux Inc.) (Table 3). Cultural morphology of the three isolates was observed and recorded (Table 4).

Table 3 . Biochemical identification of Streptomyces spp. DSa3, SAb7 and ZAb2 using API 20E® strips.



Table 4 . Cultural characterization of Streptomyces spp. DSa3, SAb7 and ZAb2.

Cultural characteristics
IsolateSpore mass colorSubstrate myceliumShape of spore chainPigmentation
ZAb2WhiteCreamyRectusYellow
DSa3Faint grayGraySpiral-
SAb7GrayGrayStraight-


According to biochemical and cultural characteristics of these isolates [3], DSa3 appeared to belong to S. aburaviensis, SAb7 belongs to S. alboniger and ZAb2 belongs to S. misionensis. Thumar et al. [63] isolated halotolerant alkaliphilic S. aburaviensis strain capable of producing antimicrobial agents.

Strain DSa3 is supposed to be S. aburaviensis. S. aburaviensis has been documented to produce antibiotics aburamycin and ablastmycin, which exhibit a broad biological profile as antibacterial, antifungal and antitumor agents, and the enzyme inhibitor ebelactone. SAb7 is suggested to be S. alboniger which produces puromycin [64], while ZAb2 is suggested to be S. misonensis which produces a microbial preparation for resisting plant pathogens [65].

PCR amplification and sequencing of 16S rDNA gene

Five different primer pairs, which were Streptomyces specific, were utilized to detect the genus specificity of the isolates. All five pairs successfully amplified the designated fragments covering multiple sites in the 16S ribosomal RNA gene (Fig. 6). In addition, all fragments were detected on gel with correct sizes in bps as expected (Table 2). This is an indispensable proof of the genus identity which was applied in previous studies identifying new Streptomyces isolates. The selected primer pairs cover the whole 16S ribosomal RNA gene and spanning multiple segments of the gene (Fig. 2), which collectively verifies the genus identity.

Figure 2.Schematic representation of the 16S ribosomal gene along with primer pair positions.

Figure 6.Gel electrophoresis of amplified Streptomyces fragments. M1: 1 kb DNA ladder marker, M2: 100 bp DNA ladder marker, 1-5 are primer pairs used in PCR as indicated in Table 2. The numbers on the left indicate band sizes in bp.

In conclusion, the soil samples collected from different regions in Jordan were rich in Streptomyces, which are important sources of antibiotic against Gram-positive bacteria mainly S. aureus, MSSA, and MRSA. However, more geographical regions in Jordan, still need much more investigation, especially in extreme environments. The most active strains were identified as S. aburaviensis, S. alboniger and S. misionensis. Further work is needed to separate and identify compounds produced by these active strains.

Acknowledgments

Go to

The authors would like to thank the Deanship of Scientific Research at the University of Jordan for the financial support of this work.

Conflict of Interest

Go to

The authors have no financial conflicts of interest to declare.

References

Go to
  1. Williams ST, Goodfellow M, Alderson G, Wellington EMH, Sneath PHA, Sackin MJ. 1983. Numerical classification of Streptomyces and related genera. J. Gen. Microbiol. 129: 1743-1813.
    Pubmed CrossRef
  2. Williams ST, Goodfellow M, Wellington EMH, Vickers JC, Alderson G, Sneath PHA, et al. 1983. A probability matrix for identification of Streptomyces. J. Gen. Microbiol. 129: 1815-1830.
    Pubmed CrossRef
  3. Goodfellow M, Kämpfer P, Busse HJ, Trujillo ME, Suzuki K, Ludwig W, Whitman WB (ed). 2012. Bergey’s manual of systematic bacteriology, vol 5. The Actinobacteria, part A and B. Springer, New York, NY.
    CrossRef
  4. Salam N, Jiao JY, Zhang XT, Li WJ. 2020. Update on the classification of higher ranks in the phylum Actinobacteria. Int. J. Syst. Evol. Microbiol. 70: 1331-1355.
    Pubmed CrossRef
  5. Lacey H, Rutledge J. 2022. Recently discovered secondary metabolites from Streptomyces species. Molecules 27: 887.
    Pubmed KoreaMed CrossRef
  6. Ayswaria R, Vasu V, Krishna R. 2020. Diverse endophytic Streptomyces species with dynamic metabolites and their meritorious applications: a critical review. Crit. Rev. Microbiol. 46: 750-758.
    Pubmed CrossRef
  7. Sivalingam P, Hong K, Pote J, Prakbakar K. 2019. Extreme environment Streptomyces: Potential sources for new antibacterial and anticancer drug leads. Int. J. Microbiol.. https://doi.org/10.1155/2019/5283948" rel="noopener">https://doi.org/10.1155/2019/5283948. Accessed on Oct. 9, 2022.
    Pubmed KoreaMed CrossRef
  8. Chater KF. 2016. Recent advances in understanding Streptomyces. F1000Res. 5: 2795.
    Pubmed KoreaMed CrossRef
  9. Hui M, Tan L, Letchumanan V, He Y-W, Fang C-M, Chan KJ, et al. 2021. The extremophilic actinobacteria: From microbes to medicine. Antibiotics 10: 682.
    Pubmed KoreaMed CrossRef
  10. Jones S, Ho L, Rees C, Hill J, Nodwell J, Elliot M. 2017. Streptomyces exploration is triggered by fungal interactions and volatile signals. ELife 6: e21738.
    Pubmed KoreaMed CrossRef
  11. Humberto EO, Ferreira LLG, Melo WGP, Oliveira ALL, Ramos Alvarenga RF, Lopes NP, et al. 2019. Antifungal compounds from Streptomyces associated with attine ants also inhibit Leishmania donovani. PLoS Negl. Trop. Dis. 13: e0007643.
    Pubmed KoreaMed CrossRef
  12. Harir M, Bendif H, Bellahcene M, Fortas Z Pogni R. 2018. Streptomyces secondary Metabolites. Basic Biology and Applications of Actinobacteria. Enany, S (ed.), IntechOpen, London.
    CrossRef
  13. Law W, Chan G, He W, Yw H, Khan T, Ab Mutalib N, et al. 2019. Diversity of Streptomyces spp. from mangrove forest of Sarawak (Malaysia) and screening of their antioxidant and cytotoxic activities. Sci. Rep. 9: 15262.
    Pubmed KoreaMed CrossRef
  14. Fangfang L, Daiwei C, Shengsheng L, Guang Y, Xiaoling Z, Zhao C, et al. 2018. Anti-influenza A viral butenolide from Streptomyces sp. Smu03 inhabiting the intestine of Elephas maximus. Viruses 10: 356.
    Pubmed KoreaMed CrossRef
  15. Bergeijk D, Terlouw B, Medema M, Wezel G. 2020. Ecology and genomics of actinobacteria: new concepts for natural product discovery. Nat. Rev. Microbiol. 18: 546-558.
    Pubmed CrossRef
  16. Nguyen HT, Pokhrel AR, Nguyen CT, Pham VTT, Dhakal D, Lim HN, et al. 2020. Streptomyces sp. VN1, a producer of diverse metabolites including non-natural furan-type anticancer compound. Sci. Rep. 10: 1756.
    Pubmed KoreaMed CrossRef
  17. Singh B, Kumar P, Haque S, Jawed A, Dubey K. 2017. Improving production of tacrolimus in streptomyces tacrolimicus (atcc 55098) through development of novel mutant by dual mutagenesis. Braz. Arch. Biol. Technol. 60: e17160366.
    CrossRef
  18. Tran T, Ameye M, Devlieghere F, De Saeger S, Eeckhout M, Audenaert K. 2021. Streptomyces strains promote plant growth and induce resistance against Fusarium verticillioides via transient regulation of auxin signaling and archetypal defense pathways in maize plants. Front. Plant Sci. 12: 755733.
    Pubmed KoreaMed CrossRef
  19. Howard T. 1953. The Production of Neomycin by Streptomyces fradiae in synthetic media. Appl. Microbiol, 1: 103-106.
    Pubmed KoreaMed CrossRef
  20. Akagawa H, Okanishi M, Umezawa H. 1975. A plasmid involved in chloramphenicol production in Streptomyces venezuelae: Evidence from genetic mapping. J. Gen. Microbiol. 90: 336-346.
    Pubmed CrossRef
  21. Sankaran L, Pogell B. 1975. Biosynthesis of puromycin in Streptomyces alboniger: regulation and properties of O-demethylpuromycin O-methyltransferase. Antimicrob. Agents Chemother. 8: 721-732.
    Pubmed KoreaMed CrossRef
  22. Distler J, Ebert A, Mansouri K, Pissowotzki K, Stockmann M. 1987. Gene cluster for streptomycin biosynthesis in Streptomyces griseus: Nucleotide sequence of three genes and analysis of transcriptional activity. Nucleic Acids Res. 15: 8041-8056.
    Pubmed KoreaMed CrossRef
  23. Swan DG, Rodríguez A, Vilches M, Méndez C, Salas JA. 1994. Characterisation of a Streptomyces antibioticus gene encoding a type I polyketide synthase which has an unusual coding sequence. Mol. Gen. Genet. 242: 358-362.
    Pubmed CrossRef
  24. Peschke U, Schmidt H, Zhang Z, Piepersberg W. 1995. Molecular characterization of the lincomycin-production gene cluster of Streptomyces lincolnensis. Mol. Microbiol. 16: 1137-1156.
    Pubmed CrossRef
  25. Nelson M, Hillen, W, Greenwald R. 2001. Tetracyclines in biology, chemistry and medicine. Birkhäuser Basel. pp. 8. doi: 10.1007/978-3-0348-8306-1.
    CrossRef
  26. Miao V. 2005. Daptomycin biosynthesis in Streptomyces roseosporus: Cloning and analysis of the gene cluster and revision of peptide stereochemistry. Microbiology 151(Pt 5): 1507-1523.
    Pubmed CrossRef
  27. Woodyer R, Shao Z, Thomas P, Kelleher N, Blodgett J, Metcalf W, et al. 2006. Heterologous production of Fosfomycin and identification of the minimal biosynthetic gene cluster. Chem. Biol. 13: 1171-1182.
    Pubmed CrossRef
  28. Atta H. 2010. Biochemical studies on antibiotic production from Streptomyces sp.: Taxonomy, fermentation, isolation and biological property. J. Saudi. Chem. Soc. 19: 12-22.
    CrossRef
  29. Wu C, Zhu H, van Wezel GP, Choi YH. 2016. Metabolomics-guided analysis of isocoumarins production by Streptomyces species MBT76 and biotransformation of flavonoids and phenylpropanoids. Metabolomics 12: 90.
    Pubmed KoreaMed CrossRef
  30. Xie F, Pathom-Aree W. 2021. Actinobacteria from desert: Diversity and biotechnological applications. Front. Microbiol, 12: 765531.
    Pubmed KoreaMed CrossRef
  31. Palmer C. 2013. Biogeography. Atlas of Jordan. Ed. Myriam Ababsa, Publications de l’Institut français du Proche-Orient Contemporary publications | CP 32 Beirut pp. 77-87. DOI: 10.4000/ books.ifpo.4560. https://books.openedition.org/ifpo/4871.
    Pubmed CrossRef
  32. Schlatter D, Fubuh A, Xiao K, Hernandez D, Hobbie S, Kinkel L. 2009. Resource amendments influence density and competitive phenotypes of Streptomyces in soil. Microb. Ecol. 57: 413-420.
    Pubmed CrossRef
  33. Law J, Ser H-L, Khan T, Chuah LH, Pusparajah P, Chan KG, et al. 2017. The potential of Streptomyces as biocontrol agents against the rice blast fungus, Magnaporthe oryzae (Pyricularia oryzae). Front. Microbiol, 8: 3.
    CrossRef
  34. Saadoun I, Ananbeh H, Ababneh Q, Jaradat Z. 2017. Comparative distribution of soil Streptomyces flora in different Jordanian habitats and their enzymatic and antibiotic activities. Res. J. Pharm. Biol. Chem. Sci. 8: 1285-1297.
  35. Suneetha V, Raj, Prathusha K. 2011. Isolation and identification of Streptomyces ST1 and ST2 strains from Tsunami affected soils: Morphological and biochemical studies. J. Oceanogr. Mar. Sci. 2: 96-101.
  36. Saadoun I, Hameed KM, Moussauui A. 1999. Characterization and analysis of antibiotic activity of some aquatic actinomycetes. Microbios 99: 173-179.
  37. Kuster E, Williams S. 1964. Selection of media for isolation of Streptomycetes. Nature 202: 928-929.
    Pubmed CrossRef
  38. Shirling E, Gottlieb D. 1966. Methods, classification, identification and description of genera and species. The Williams and Wilkins Company, Baltimore. 2: 61-292.
  39. Dal Pizzol M, Freitas E, Locatelli C, Guareze F, Reginatto P, Machado G, et al. 2021. Antifungal efficacy and safety of cycloheximide as a supplement in optisol-GS. Drug Des. Devel. Ther. 15: 2091-2098.
    Pubmed KoreaMed CrossRef
  40. Oskay M. 2009. Comparison of Streptomyces diversity between agricultural and non-agricultural soils by using various culture media. Sci. Res. Essay 4: 997-1005.
  41. Madigan MT, Martinko JM, Parker J. 1997. Brock Biology of Microorganisms. 8th Edition, Prentice Hall International, Inc., New York.
  42. Le Page S, van Belkum A, Fulchiron C, Huguet R, Raoult D, Rolain J. 2015. Evaluation of the PREVI® Isola automated seeder system compared to reference manual inoculation for antibiotic susceptibility testing by the disk diffusion method. Eur. J. Clin. Microbiol. Infect. Dis. 34: 1859-1869.
    Pubmed CrossRef
  43. Shirling E, Gottlieb D. 1966. Methods for characterization of Streptomyces species. Int. J. Syst. Evol. Microbiol. 16: 313-340.
    CrossRef
  44. Saadoun I, Al-Momani F. 1997. Studies on soil Streptomycetes from Jordan. Actinomycetes 8: 42-48.
  45. Saadoun I, Gharaibeh R. 2002. The Streptomyces flora of Jordan and its' potential as a source of antibiotics active against antibiotic-resistant Gram-negative bacteria. World J. Microbiol. Biotechnol. 18: 465-470.
  46. Saadoun I, Gharaibeh R. 2003. The Streptomyces flora of Badia region of Jordan and its potential as a source of antibiotic-resistant bacteria. J. Arid. Environ. 53: 365-371.
    CrossRef
  47. Saadoun I, Al-Momani F, Malkawi H, Mohammad M. 1999. Isolation, identification and analysis of antibacterial activity of soil Streptomycetes isolates from north Jordan. Microbios 100: 41-46.
  48. Saadoun I, Hameed K, Al-Momani F, Malkawi H, Meqdam M, Mohammad M. 2000. Characterization and analysis of antifungal activity of soil Streptomycetes isolated from North Jordan. Egypt J. Microbiol. 35: 463-471.
  49. Saadoun I, Muhana A. 2008. Optimal production conditions, extraction, partial purification and characterization of inhibitory compound(s) produced by Streptomyces Ds-104 isolate against multi-drug resistant Candida albicans, Curr. Trends Biotechnol. Pharm. 2: 402-420.
  50. Kouadri F, Al-Aboudi A, Khyami-Horani H. 2014. Antimicrobial activity of Streptomyces sp. isolated from the gulf of Aqaba-Jordan and screening for NRPS, PKS-I, and PKS-II genes. Afr. J. Biotechnol. 13: 3505-3515.
    CrossRef
  51. Rawashdeh R, Saadoun I, Mahasneh A. 2005. Effect of cultural conditions on xylanase production by Streptomyces sp. (strain Ib 24D) and its potential to utilize tomato pomace Afr. J. Biotechol. 4: 251-255.
  52. Martínez-Castro M, Barreiro C, Romero F, Fernández-Chimeno R, Martín J. 2011. Streptomyces tacrolimicus sp. nov., a low producer of the immunosuppressant tacrolimus (FK506). Int. J. Syst. Evol. Microbiol. 61: 1084-1088.
    Pubmed CrossRef
  53. Yao JY, Yin WL, Li XC, Li G, et al. 2014. Anti-parasitic activities of specific bacterial extracellular products of Streptomyces griseus SDX-4 against Ichthyophthirius multifiliis. Parasitol. Res. 113: 3111-3117.
    Pubmed CrossRef
  54. Abd-Elnaby H, Abo-Elala G, Abdel-Raouf U, Abdelwahab A, Hamed M. 2016. Antibacterial and anticancer activity of marine Streptomyces parvus: Optimization and application. Biotechnol. Biotechnol. Equip. 30: 180-191.
    CrossRef
  55. Silambarasan S, Praveen E, Murugan T, Saravanan D, Balagurunathan R. 2012. Antibacterial and antifungal activities of actinobacteria isolated from Rathnagiri hills. J. Appl. Pharm. Sci. 2: 99-103.
    CrossRef
  56. Valli S, Svathi Sugasini S, Aysha OS, Nirmala P, Vinoth Kumar P, Reena A. 2012. Antimicrobial potential of Actinomycetes species isolated from marine environment. Asian Pac. J. Trop. Biomed. 2: 469-473.
    Pubmed CrossRef
  57. Al-Ansari M, Alkubaisi N, Vijayaragavan P, Murugan K. 2019. Antimicrobial potential of Streptomyces sp. to the Gram positive and Gram-negative pathogens. J. Infect. Public Health 12: 861-866.
    Pubmed CrossRef
  58. Jalal K, Hasan A. 2021. Molecular and phenotypic characterization of novel Streptomyces species isolated from Kurdistan soil and its antibacterial activity against human pathogens. Jordan J. Biol. Sci. 14: 441-451.
    CrossRef
  59. Meliani M, Denis F, Mohamed-Benkada M, Gabed N, et al. 2022. Characterization of Actinomycetes strains isolated from Cheliff Estuary in the North-West of Algeria. Jordan J. Biol. Sci. 15: 7-14.
    CrossRef
  60. Tenebro CP, Trono DJ, Vicera CV, Sabido EM, Ysulat JA, Macaspac JM, et al. 2021. Multiple strain analysis of Streptomyces species from Philippine marine sediments reveals intraspecies heterogeneity in antibiotic activities. Sci. Rep. 11: 17544.
    Pubmed KoreaMed CrossRef
  61. Magaldi S, Mata-Essayag S, Hartung de Capriles C. 2004. Well diffusion for antifungal susceptibility testing. Int. J. Infect. Dis. 8: 39-45.
    Pubmed CrossRef
  62. Valgas C, De Souza S, Smânia E, Smânia A Jr. 2007. Screening methods to determine antibacterial activity of natural products. Braz. J. Microbiol. 38: 369-380.
    CrossRef
  63. Thumar JT, Dhulia K, Singh SP. 2010. Isolation and partial purification of an antimicrobial agent from halotolerant alkaliphilic Streptomyces aburaviensis strain Kut-8. World. J. Microbiol. Biotechnol. 26: 2081-2087.
    CrossRef
  64. Vara J, Perez-Gonzalez JA, Jimenez A. 1985. Biosynthesis of puromycin by Streptomyces alboniger: Characterization of puromycin N-acetyltransferase. Biochemistry 24: 8074-8081.
    Pubmed CrossRef
  65. Yoon BD, Park CS, Kim MS, Ahn GH, Yang HJ. 2009. Microbial preparation, containing Streptomyces misonensis CJS-70, for resisting plant pathogens. Republic of Korea, KR2009129181 A 2009-12-16.

Article Tools

Starts of Metrics

Share this article on :

Related articles in MBL

Most Searched Keywords ?

What is Most Searched Keywords?

  • It is most registrated keyword in articles at this journal during for 2 years.