Contact us
닫기
Article Search
닫기

Microbiology and Biotechnology Letters

Research Article(보문)

View PDF

Molecular and Cellular Microbiology (MCM)  |  Host-Microbe Interaction and Pathogenesis

Microbiol. Biotechnol. Lett. 2024; 52(4): 462-469

https://doi.org/10.48022/mbl.2409.09004

Received: September 4, 2024; Revised: October 19, 2024; Accepted: October 21, 2024

In-vitro Evaluation of Free Radical Scavenging Activities and Inflammatory Markers from LPS-Induced MH-S Cells by Xanthium strumarium L.

Abdul Wahab Akram, Uyanga Batmunkh, and Man Hee Rhee*

College of Veterinary Medicine & Institute for Veterinary Biomedical Science, Kyungpook National University, Daegu 41566, Republic of Korea

Correspondence to :
Man Hee Rhee,        rheemh@knu.ac.kr

Abstract

Go to

Plants are a cornerstone of traditional medicine because they produce diverse chemical compounds with therapeutic potential. The genus Xanthium, particularly Xanthium strumarium, is renowned for its broad range of pharmacological effects but its anti-inflammatory properties in lipopolysaccharide (LPS)-induced MH-S cells remain underexplored. This research investigates anti-inflammatory and antioxidant activities of X. strumarium ethanol extract on LPS-stimulated MH-S cells. X. strumarium was extracted with ethanol and analyzed for its chemical composition using Gas chromatography–mass spectrometry (GC-MS). The antioxidant activity was evaluated through DPPH and ABTS assays while anti-inflammatory activity was evaluated in LPS stimulated MH-S cells by assessing nitric oxide (NO) production. Additionally, the expression of inflammatory cytokines and mediators (TNF-α, IL-1β, IL-6, iNOS, and COX-2) was assessed via RT-PCR and qRT PCR. GC-MS analysis identified several major compounds in the extract, including fatty acids and phenolic compounds. Significant free radical scavenging activity was revealed in the antioxidant assays, particularly in the ABTS assay. In MH-S cells, X. strumarium extract dose-dependently reduced NO production and inhibited the expression of inflammatory cytokines and mediators without causing cytotoxicity. X. strumarium exhibits potent anti-inflammatory and antioxidant properties, as evidenced by its ability to reduce NO production and downregulate inflammatory cytokines and mediators in LPS-stimulated MH-S cells. These findings support the potential of X. strumarium as a natural anti-inflammatory agent and underscore its therapeutic potential in managing oxidative stress and inflammation. Future research should further elucidate the mechanistic pathways underlying these effects.

Keywords: Xanthium strumarium L, antioxidant effects, anti-inflammatory effects, free radicals scavenging, Nitric oxide (NO) production, LPS-stimulated MH-S cells

Graphical Abstract


Introduction

Go to

The use of herbal plants as a key source of phytomedicine over the centuries is not accidental [1]. The immense chemical diversity within the plant kingdom offers numerous opportunities to target and treat a wide array of ailments [2]. Many plant-derived metabolites evolved for interspecies chemical communication and have inherent drug-like characteristics. These compounds can effectively interact with protein targets or influence the growth of commensal, pathogenic, or parasitic organisms within the body [3]. The application of new phytochemistry and pharmaceutical methods has facilitated the exploration of the mechanisms and chemical constituents of plants employed in traditional medicine [4]. Numerous compounds derived from plants demonstrate biological activities capable of reducing oxidative stress and mitigating inflammatory diseases [5, 6].

Typically, inflammatory reactions occur as a physiological reaction to adverse stimuli, like pathogen invasion and toxin exposure [7]. However, aberrant and abnormal inflammation can lead to various anomalies [8, 9]. Macrophages are essential players in inflammation, primarily due to their production of pro-inflammatory mediators. These include nitric oxide (NO), inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), as well as cytokines such as interleukin-1β (IL-1β), interleukin- 6 (IL-6), and tumor necrosis factor-α (TNF-α) [10]. Stimulation of TLR4 by lipopolysaccharide (LPS) initiates a signaling cascade including MyD88 independent and dependent pathways, leading to upregulation of proinflammatory cytokines [11]. NO is synthesized through the inducible iNOS pathway in response to inflammatory triggers, including LPS [12]. In chronic inflammation, activated macrophages release elevated levels of chemokines, cytokines, and pro-inflammatory mediators [13]. Conversely, oxygen metabolism naturally produces reactive oxygen species (ROS), which are essential for homeostasis and cell signaling [14]. However, excessive ROS generation can oxidize proteins and nucleic acids in pathological infections, which can have harmful consequences on cell structures [15].

The genus Xanthium, a member of the Asteraceae family, comprises a taxonomically intricate genus with over 20 species worldwide, including three species and one variety in China [16, 17]. X. strumarium L., commonly found along streets and in fields in China, Korea, Northeast Asia, and Europe [18], is an annual herb standing 20−90 cm tall with erect, branched stems often tinged with purple and adorned with short white hairs. Its green, cauline leaves are primarily alternate, with lanceolate, linear, or ovate blades [19]. X. strumarium exhibits a broad spectrum of pharmacological effects, including anti-androgen receptor activity, anti-tumor properties, analgesic, insecticidal, and antiparasitic effects, as well as antioxidant, antibacterial, antifungal, antidiabetic, antilipidemic, and antiviral activities [20]. However, its role in inhibiting LPS-induced inflammatory cytokines (TNF-α, IL-1β, IL-6), and pro-inflammatory mediators (NO, iNOS, and COX-2) in MH-S cells remains unexplored. Therefore, ethanol extract of X. strumarium was administered at different concentrations to MH-S cells in the presence or absence of LPS and the expression of inflammatory cytokines (TNF-α, IL-1β, IL-6), and pro-inflammatory mediators (NO, and COX-2) was evaluated via reverse transcription polymerase chain reaction (RT-PCR) and qRT-PCR.

Materials and Methods

Go to

Reagents

DPPH reagent was obtained from Sigma-Aldrich (CAS:1898-66-4); ABTS reagent was acquired from Roche Diagnostics (Germany; REF: 10102946001); potassium persulfate was obtained from Sigma-Aldrich (216224-100G); RPMI for MH-S cells culture was sourced from Daegu, Korea; streptomycin/penicillin were imported from Lonza (USA); FBS and DPBS were obtained from WelGene Co. (Republic of Korea); RNA was extracted with TRIzol® reagent (Invitrogen, USA); bovine serum albumin was acquired from Thermo Fisher Scientific (Republic of Korea); oligo-dT for oligo synthesis was obtained from Bioneer; all primers were soured from Bioneer (Republic of Korea); MTT reagent was purchased from Sigma-Aldrich; all western blot antibodies were purchased from Cell Signaling Technology (USA).

Extraction of Xanthium strumarium

X. strumarium extract was procured as recently described [21]. In brief, X. strumarium was subjected to extraction by incubating 1 part plant to 20 parts 70% EtOH (weight/volume) at 80℃ for 2 h. The extracted solvent was filtered through filter paper (Whatman™ No.4), evaporated using a rotary evaporator, and frozen overnight (-70℃). Powdered X. strumarium was obtained after freeze-drying the extracted solvent for 3−4 days at -55℃. Dimethyl sulfoxide (DMSO) was utilized to dissolve ethanol extracts at specific concentrations for subsequent sample evaluation.

GC-MS analysis

GC-MS analysis was performed by injecting powdered extract at 250℃ using an Agilent 7890A GC instrument (Agilent Technologies, USA) with the temperature of the source set at 230℃ and the transfer line set at 280℃. The column temperature was maintained at 70℃ for 1 min and increased at a rate of 5℃/min to a final temperature of 300℃ and maintained for 30 min. Mass spectrometry (MS) data were collected using scan and electron ionization modes to analyze the compounds found within the X. strumarium extract. Table 1 lists the major compounds present in X. strumarium extract.

Table 1 . GC-MS analysis of major compounds present in Xanthium strumarium extract.

Chemical CompoundsRetention timeArea%
9,12-Octadecadienoic acid42.962.94
n-Hexadecanoic acid39.591.35
6,9-octadecanoic acid43.020.73
octadecanoic acid43.350.63
1,3,4,5-tetrahydroxycyclohexanecar32.510.39
2,1,3-benzothiadiazole27.760.23
1,2,3 Propanetriol16.020.22
Glycerin15.420.11
Hydroquinone23.300.09


DPPH and ABTS assays

For the DPPH assay, 20 μl of X. strumarium (15.6− 1000 μg/ml) or ascorbic acid (100 μg/ml, positive control) were incubated with DPPH reagent for 20−30 min. Then, absorbance was measured at 517 nm, and ROS scavenging was quantified as previously described [10].

For the ABTS assay, 50 μl of X. strumarium (15.6 to 1000 μg/ml) or Trolox (10 mm, positive control) were reacted with ABTS reagent. Then, absorbance was measured at 734 nm, and ROS scavenging was quantified as previously described [10].

Cell culture, NO assay, and cell viability (MTT) assay

MH-S cells, originating from the American Type culture collection, were kept in RPMI medium (10% FBS, 10,000 IU/ml penicillin, and 10,000 μg/ml streptomycin sulfate supplementation) under humidified conditions with 5% CO2 at 37℃. Following 24 h of seeding the cells in 24-well plates at a concentration of 2 × 105 cells per well, LPS (0.1 μg/ml) was used to stimulate the cells for an additional 18 h, with or without X. strumarium (50 to 200 μg/ml). For the NO assay, a volume of 100 μl supernatant was obtained from culture media and reacted with 100 μl of Griess reagent A and B mixture, followed by measuring the absorbance at 540 nm. For the cell viability (MTT) assay, after taking 100 μl supernatant, MTT reagent (0.1 mg/ml) was reacted with the cells for 3−4 h to measure cell viability, and the resulting violet crystals were quantified at 560 nm.

RT-PCR and qRT PCR

MH-S cells were incubated in six-well plates for 24 h. Then, the cells were stimulated with 0.1 μg/ml LPS for 18 h in the presence or absence of X. strumarium at specified doses ranging from 50 to 200 μg/ml. RNA was extracted using TRIzol® reagent, then the RNA was annealed for 10 min at 70℃ with oligo-dT, placed on ice for 10 min, and then incubated for 1 h 30 min at 42.5℃. The reverse transcriptase was activated by heating the mixture for 5 min at 95℃. Subsequently, the generated cDNA was amplified with targeted primers, and the final PCR products were run on a 1% agarose gel for visualization. Band identification was facilitated using Eagle Eye image analysis software (USA). Table 2 provides the primer sequences utilized for qRT PCR analysis and RT-PCR.

Table 2 . Primers sequence used for RT-PCR and qRT PCR analysis.

RT-PCRForward primer sequences (5’-3’)Reverse primer sequences (5’-3’)
COX-2CACTACATCCTGACCCACTTATGCTCCTGCTTGAGTATGT
iNOSCCCTTCCGAAGTTTCTGGCAGCAGCGGCTGTCAGAGCCTCGTGGCTTTGG
IL-6GTACTCCAGAAGACCAGAGGTGCTGGTGACAACCACGGCC
TNF-αTTGACCTCAGCGCTGAGTTGCCTGTAGCCCACGTCGTAGC
IL-1βCTGTGGAGAAGCTGTGGCAGGGGATCCACACTCTCCAGCT
GAPDHCACTCACGGCAAATTCAACGGCACGACTCCACGACATACTCAGCAC
Real-time PCR
COX-2GGCAGCCTGTGAGACCTTTGGCATTGGAAGTGAAGCGTTTC
iNOSGGCAGCCTGTGAGACCTTTGGCATTGGAAGTGAAGCGTTTC
IL-6TCCAGTTGCCTTCTTGGGACGTGTAATTAAGCCTCCGACTTG
TNF-αTGCCTATGTCTCAGCCTCTTCGAGGCCATTTGGGAACTTCT
IL-1βCAACCAACAAGTGATATTCTCCATGGATCCACACTCTCCAGCTGCA
GAPDHCACTCACGGCAAATTCAACGGCACGACTCCACGACATACTCAGCAC


2 μl PCR product from each group was subjected to qRT PCR using the Bio-Rad CFX96 Real-Time Thermal Cycler (Bio-Rad, USA). Gene expression was normalized against the housekeeping gene GAPDH.

Statistical analysis

Data was analyzed using one-way ANOVA, followed by Dunnett’s post hoc test (SAS Institute Inc., USA) to evaluate the statistical significance of the differences observed. Results are expressed as mean ± standard deviation (SD), with a p-value of 0.05 or less considered statistically significant.

Results

Go to

Identification of compounds from X. strumarium

GC-MS analysis of X. strumarium revealed several major compounds, including 9,12-octadecadienoic acid, n-hexadecanoic acid, 6,9-octadecanoic acid, octadecanoic acid, 1,3,4,5-tetrahydroxycyclohexanecar, 2,1,3-benzothiadiazole, 1,2,3-propanetriol, glycerin, hydroquinone, catechol, phenol, 5,6-dihydro-2-phenylthiazol, and 2,4- dimethyl-7H-benzofluorene (See Table 1 for details).

X. strumarium possesses potent free radical scavenging activity in ABTS and DPPH assays

X. strumarium exhibited potent radical scavenging activity, which increased with increasing doses from 15.6−1000 μg/ml (Fig. 1). In the DPPH assay, X. strumarium at 1,000 μg/ml completely scavenge free radicals produced by DPPH reagent and its radical scavenging activity was comparable to that of ascorbic acid (Fig. 1A). Similarly, our plant sample exhibited higher radical scavenging activity at 1000 μg/ml in the ABTS assay compared to the DPPH assay (Fig. 1B). These findings suggest that X. strumarium displays stronger antioxidant effects in the ABTS assay, possibly which could be attributed to the flavonoid and phenolic components presence.

Figure 1.Reactive oxygen species scavenging activity of X. strumarium evaluated with DPPH (A) and ABTS (B) assays. Values in the bar graphs are the means ± standard error of the mean (SEM) of at least 3 independent experiments. ***p < 0.001 and, **p < 0.01, *p < 0.05 against ascorbic acid (100 μg/ml, ***p < 0.001 against Trolox (10 mm).

X. strumarium reduces NO production without cell cytotoxicity

In our experimental setup, MH-S cells were treated with different concentrations of X. strumarium (50−1000 μg/ml) in the presence or absence of LPS. LPS induced NO production in MH-S cells, significantly higher compared to basal. However, treatment with X. strumarium resulted in reduction in NO production, with NO production significantly decreasing following treatment with 50 μg/ml of the X. strumarium sample and reaching its lowest level with 200 μg/ml of the sample (Fig. 2A). Further, MTT assay was performed at the indicated concentration using supernatant from the treated MH-S cells. X. strumarium exhibited no cytotoxic effects, indicating that the reduction in inflammatory response was not caused by cell death (Fig. 2B).

Figure 2.The anti-inflammatory activity of X. strumarium was analyzed with an NO assay (A) and cell viability was assessed using an MTT assay (B). Following 24 h of seeding the cells, LPS 0.1 μg/ml was used to stimulate the cells for an additional 18 h, with or without X. strumarium 50 to 200 μg/ml. Griess reagent was used to measure NO from the cell supernatant (A) and the MTT reagent 0.1 mg/ml was reacted with the cells for 3-4 h to measure the cell viability (B). The means ± standard error of the mean (SEM) are represented. ***p < 0.001, **p < 0.01, *p < 0.05.

X. strumarium reduces inflammatory cytokines and proinflammatory mediators in MH-S cells

Furthermore, we investigated the suppression of inflammatory cytokines through RT-PCR analysis. The mRNA expression levels of iNOS, COX-2, IL-1β, IL-6, and TNF-α reduced with increasing concentrations of X. strumarium (Fig. 3). However, iNOS, COX-2, and TNF-α were significantly inhibited in a dose dependent manner from 50 μg/ml to 1000 μg/ml. These findings suggest that X. strumarium mitigates inflammation by attenuating the production of pro-inflammatory mediators and cytokines. Further, the qRT PCR results confirmed that inflammatory gene expression was inhibited after X. strumarium treatment (Fig. 4).

Figure 3.Inflammatory mediator and cytokine gene expression was evaluated with RT-PCR and qRT PCR. For RT-PCR, cells were grown in 6-well plates and RNA was extracted 18 h after stimulation using LPS 0.1 μg/ml with or without X. strumarium 50 to 200 μg/ml. cDNA was then produced and gel electrophoresis was performed. Mean ± standard error of the mean (SEM) are represented. ***p < 0.001, **p < 0.01, and *p < 0.05.

Figure 4.qRT PCR was performed using the PCR product and a Bio-Rad CFX96 Real-Time Thermal Cycler (USA). The gene expression was normalized against the housekeeping gene GAPDH. ***p < 0.001, **p < 0.01, and *p < 0.05 represent the means ± standard error of the mean (SEM).

Discussion

Go to

Natural remedies have long been used to address a wide range of physiological disorders [22]. Scientific advancements now allow us to delve into the molecular mechanisms behind the pharmacological effects of compounds found in natural products such as herbs, shrubs, roots, leaves, and flowers. X. strumarium, a medicinal plant, is utilized in traditional medicine across North America, China, Malaysia, and Pakistan [23, 24]. X. strumarium is associated with cooling, laxative, fattening, anthelmintic, alexiteric, tonic, digestive, and antipyretic effects in Ayurvedic medicine [24]. It is also believed to enhance appetite, improve voice and complexion, and boost memory. Additionally, it is used to treat various conditions, including leukoderma, biliousness, insect bites, epilepsy, excessive salivation, and fever [24].

ABTS radicals react through electron transfer, while DPPH radicals engage hydrogen atom transfer mechanisms [25, 26]. Our plant extract demonstrated higher radical scavenging activity in the ABTS assay, indicating that its potent antioxidant activity may be attributed to its phenolic and flavonoid constituents (Table 1, Fig. 1). These findings are consistent with prior studies highlighting the robust radical scavenging properties of phenols and flavonoids [27].

NO is a gaseous molecule involved in cellular defense mechanisms against external pathogens [28]. However, prolonged NO production can lead to cellular damage [29]. In our study, stimulating MH-S cells with LPS elevated NO production in a dose-dependent manner. However, treatment with X. strumarium ethanol extract at 50−200 μg/ml significantly and dose-dependently reduced the LPS-induced NO production and did not exhibit cytotoxic effects (Fig. 2). These results are in line with earlier research where RAW 264.7 cells were activated with LPS either with or without X. strumarium methanol extract [30].

Pro-inflammatory mediators iNOS and COX-2 can be produced as a result of NO synthesis, which is thought to be a defense mechanism against LPS invasion [30−32]. The cytokines IL-1β, IL-6, and TNF-α are among the mediators that set off downstream signaling pathways [33]. The increased release of these cytokines can exacerbate inflammation and tissue damage [34]. Treatment with X. strumarium significantly reduced mRNA expression of iNOS, COX-2, IL-1β, IL-6, and TNF-α in a dose-dependent manner, as confirmed by qRT PCR. These findings underscore the anti-inflammatory efficacy of X. strumarium in mitigating LPS-induced inflammation (Figs. 3 and 4). NF-κB is a key canonical pathway triggered by toxins to induce inflammatory responses [35]. This pathway is typically activated when lipopolysaccharide (LPS) binds to the TLR4 receptor [36]. Upon this receptor-ligand interaction, a cascade of signaling molecules is activated, leading to inflammation, and needs to be further explored with X. strumarium using MH-S cells in the future studies. A schematic illustration of the anti-inflammatory and antioxidative effects of X. strumarium is shown in Fig. 5.

Figure 5.Schematic representation of the anti-inflammatory and antioxidative effects of X. strumarium.

In conclusion, this study demonstrates the potent antiinflammatory and antioxidant properties of X. strumarium ethanol extract in MH-S cells. The extract significantly reduced NO production in LPS-stimulated MH-S cells without exhibiting cytotoxic effects. Additionally, it downregulated the mRNA expression levels of proinflammatory mediators including iNOS, COX-2, IL-1β, IL-6, and TNF-α. These findings underscore the therapeutic potential of X. strumarium in mitigating inflammatory responses and oxidative stress. Natural products have been extensively used throughout history, and recent scientific evaluations reveal that these natural compounds can be as effective as synthetic drugs but with fewer side effects. This research supports the potential of X. strumarium as a natural anti-inflammatory agent and explores the anti-inflammatory activity of X. strumarium in MH-S cells for the first time. Future studies are required to assess the mechanisms of X. strumarium anti-inflammatory activity in MH-S cells.

Acknowledgments

Go to

We are grateful to Abdul Wahab Akram for data curation, methodology, writing original draft and final review. We are thankful to Uyanga Batmunkh for writing final review and other technical help. We are grateful to Professor Man Hee Rhee for his continuous supervision and support. This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korean government (MSIT) (No. 2022R1A2C1012963). We are thankful to the National Research Foundation of Korea (NRF) for the grants.

Conflict of Interest

Go to

The authors have no financial conflicts of interest to declare.

References

Go to
  1. Li F-S, Weng J-K. 2017. Demystifying traditional herbal medicine with modern approach. Nat. Plants 3: 1-7.
    Pubmed CrossRef
  2. Chopra B, Dhingra AK. 2021. Natural products: A lead for drug discovery and development. Phytother. Res. 35: 4660-4702.
    Pubmed CrossRef
  3. Conrado R, Gomes TC, Roque GSC, De Souza AO. 2022. Overview of bioactive fungal secondary metabolites: cytotoxic and antimicrobial compounds. Antibiotics 11: 1604.
    Pubmed KoreaMed CrossRef
  4. Saxena R. 2023. Exploring approaches for investigating phytochemistry: Methods and techniques. Medalion Journal: Medical Research, Nursing, Health Midwife Participation 4: 65-73.
    CrossRef
  5. Mucha P, Skoczyńska A, Małecka M, Hikisz P, Budzisz E. 2021. Overview of the antioxidant and anti-inflammatory activities of selected plant compounds and their metal ions complexes. Molecules 26: 4886.
    Pubmed KoreaMed CrossRef
  6. Salehi B, Azzini E, Zucca P, Maria Varoni E, V. Anil Kumar N, Dini L, et al. 2020. Plant-derived bioactives and oxidative stress-related disorders: a key trend towards healthy aging and longevity promotion. Appl. Sci. 10: 947.
    CrossRef
  7. Santacroce L, Topi S, Charitos IA, Lovero R, Luperto P, Palmirotta R, et al. 2024. Current views about the inflammatory damage triggered by bacterial superantigens and experimental attempts to neutralize superantigen-mediated toxic effects with natural and biological products. Pathophysiology 31: 18-31.
    Pubmed KoreaMed CrossRef
  8. Megha KB, Joseph X, Akhil V, Mohanan PV. 2021. Cascade of immune mechanism and consequences of inflammatory disorders. Phytomedicine 91: 153712.
    Pubmed KoreaMed CrossRef
  9. Wang RX, Zhou M, Ma HL, Qiao YB, Li QS. 2021. The role of chronic inflammation in various diseases and anti‐inflammatory therapies containing natural products. ChemMedChem. 16: 1576-1592.
    Pubmed CrossRef
  10. Wahab A, Sim H, Choi K, Kim Y, Lee Y, Kang B, et al. 2023. Antioxidant and anti-inflammatory activities of Lespedeza cuneata in coal fly ash-induced murine alveolar macrophage cells. Korean J. Vet. Res. 63: 27-21.
    CrossRef
  11. George G, Shyni GL, Abraham B, Nisha P, Raghu KG. 2021. Downregulation of TLR4/MyD88/p38MAPK and JAK/STAT pathway in RAW 264.7 cells by Alpinia galanga reveals its beneficial effects in inflammation. J. Ethnopharmacol. 275: 114132.
    Pubmed CrossRef
  12. Cinelli MA, Do HT, Miley GP, Silverman RB. 2020. Inducible nitric oxide synthase: Regulation, structure, and inhibition. Med. Res. Rev. 40: 158-189.
    Pubmed KoreaMed CrossRef
  13. Baek S-H, Park T, Kang M-G, Park D. 2020. Anti-inflammatory activity and ROS regulation effect of sinapaldehyde in LPS-stimulated RAW 264.7 macrophages. Molecules 25: 4089.
    Pubmed KoreaMed CrossRef
  14. Zhang B, Pan C, Feng C, Yan C, Yu Y, Chen Z, et al. 2022. Role of mitochondrial reactive oxygen species in homeostasis regulation. Redox Rep. 27: 45-52.
    Pubmed KoreaMed CrossRef
  15. Jomova K, Raptova R, Alomar SY, Alwasel SH, Nepovimova E, Kuca K, et al. 2023. Reactive oxygen species, toxicity, oxidative stress, and antioxidants: Chronic diseases and aging. Arch. Toxicol. 97: 2499-2574.
    Pubmed KoreaMed CrossRef
  16. Linh NTT, Son NT, Ha NTT, Tra NT, Tu Anh LT, Chen S, et al. 2021. Biologically active constituents from plants of the genus Xanthium. Progress Chem. Org. Nat. Prod. 116: 135-209.
    Pubmed CrossRef
  17. Islam MR, Uddin MZ, Rahman MS, Tutul E, Rahman MZ, Hassan MA, et al. 2009. Ethnobotanical, phytochemical and toxicological studies of Xanthium strumarium L. Bangladesh Med. Res. Counc. Bull. 35: 84-90.
    Pubmed CrossRef
  18. Bark K-M, Heo EP, Han KD, Kim M-B, Lee S-T, Gil E-M, et al. 2010. Evaluation of the phototoxic potential of plants used in oriental medicine. J. Ethnopharmacol. 127: 11-18.
    Pubmed CrossRef
  19. Fan W, Fan L, Peng C, Zhang Q, Wang L, Li L, et al. 2019. Traditional uses, botany, phytochemistry, pharmacology, pharmacokinetics and toxicology of Xanthium strumarium L. A review. Molecules 24: 359.
    Pubmed KoreaMed CrossRef
  20. Wang J, Wang D, Wu B, Han J, Tan N. 2024. Phytochemical and pharmacological properties of Xanthium species: a review. Phytochem. Rev. 9: 1-72.
    CrossRef
  21. Akram AW, Saba E, Rhee MH. 2024. Antiplatelet and antithrombotic activities of Lespedeza cuneata via pharmacological inhibition of integrin αIIbβ3, MAPK, and PI3K/AKT pathways and FeCl3‐Induced murine thrombosis. Evid. Based Complement. Alter. Med. 2024: 9927160.
    Pubmed KoreaMed CrossRef
  22. Yuan H, Ma Q, Ye L, Piao G. 2016. The traditional medicine and modern medicine from natural products. Molecules 21: 559.
    Pubmed KoreaMed CrossRef
  23. Mouhamad RS. 2022. Evaluate the influence of Xanthium strumarium L. extract on blood sugar levels in healthy and diabetic mice. J. Clin. Cases Rep. DOI: 10.46619/joccr.2022.5-2.1109.
    CrossRef
  24. Khan Y, Shah S, Ullah S. 2020. Ethnomedicinal, pharmacological and phytochemical evaluation of Xanthium strumarium L. Int. J. Sci. Eng. Res. 11: 587-595.
  25. Miller NJ, Rice-Evans CA. 1997. Factors influencing the antioxidant activity determined by the ABTS•+ radical cation assay. Free Rad. Res. 26: 195-199.
    Pubmed CrossRef
  26. Kedare SB, Singh RP. 2011. Genesis and development of DPPH method of antioxidant assay. J. Food Sci. Technol. 48: 412-422.
    Pubmed KoreaMed CrossRef
  27. Zeb A. 2020. Concept, mechanism, and applications of phenolic antioxidants in foods. J. Food Biochem. 44: e13394.
    Pubmed CrossRef
  28. Gantner BN, LaFond KM, Bonini MG. 2020. Nitric oxide in cellular adaptation and disease. Redox Biol. 34: 101550.
    Pubmed KoreaMed CrossRef
  29. Simpson DSA, Oliver PL. 2020. ROS generation in microglia: understanding oxidative stress and inflammation in neurodegenerative disease. Antioxidants 9: 743.
    Pubmed KoreaMed CrossRef
  30. Lyu J-H, Yoon H-J, Hong S-H, Ko W-S. 2008. Xanthium strumarium suppresses degranulation and pro-inflammatory cytokines secretion on the mast cells. J. Korean Med. Ophthalmol. Otolaryngol. Dermatol. 21: 82-93.
  31. Lin C-Y, Kao S-H, Hung L-C, Chien H-J, Wang W-H, Chang Y-W, et al. 2021. Lipopolysaccharide-induced nitric oxide and prostaglandin E2 production is inhibited by tellimagrandin II in mouse and human macrophages. Life 11: 411.
    Pubmed KoreaMed CrossRef
  32. Alaguvel S, Sundaramurthy D. 2024. Unveiling the anti-cancer, anti-inflammatory, anti-oxidant and anti-bacterial properties of in situ phyto-fabricated silver nanoparticles: an in vitro approach. New J. Chem. 48: 11366-11376.
    CrossRef
  33. Skelly DT, Hennessy E, Dansereau M-A, Cunningham C. 2013. A systematic analysis of the peripheral and CNS effects of systemic LPS, IL-1β, TNF-α and IL-6 challenges in C57BL/6 mice. PLoS One 8: e69123.
    Pubmed KoreaMed CrossRef
  34. Ullah HMA, Kwon T-H, Park S, Kim SD, Rhee MH. 2021. Isoleucilactucin ameliorates coal fly ash-induced inflammation through the NF-κB and MAPK pathways in MH-S cells. Int. J. Mol. Sci. 22: 9506.
    Pubmed KoreaMed CrossRef
  35. Yu H, Lin L, Zhang Z, Zhang H, Hu H. 2020. Targeting NF-κB pathway for the therapy of diseases: mechanism and clinical study. Signal Transduct. Target. Ther. 5: 209.
    Pubmed KoreaMed CrossRef
  36. Ni J, Zhao Y, Su J, Liu Z, Fang S, Li L, et al. 2020. Toddalolactone protects lipopolysaccharide-induced sepsis and attenuates lipopolysaccharide-induced inflammatory response by modulating HMGB1-NF-κB translocation. Front. Pharmacol. 11: 109.
    Pubmed KoreaMed CrossRef

Article Tools

Starts of Metrics

Share this article on :

Most Searched Keywords ?

What is Most Searched Keywords?

  • It is most registrated keyword in articles at this journal during for 2 years.