Contact us
닫기
Article Search
닫기

Microbiology and Biotechnology Letters

보문(Article)

View PDF

Molecular and Cellular Microbiology (MCM)  |  Microbial Genetics, Physiology and Metabolism

Microbiol. Biotechnol. Lett. 2022; 50(2): 301-309

https://doi.org/10.48022/mbl.2202.02009

Received: February 19, 2022; Revised: June 3, 2022; Accepted: June 7, 2022

Zerumbone 처리 헬리코박터 파이로리균의 전사체 분석 비교

Comparative Transcriptome Analysis of Zerumbone-Treated Helicobacter pylori

Hyun Jun Woo1†, Ji Yeong Yang2†, and Sa-Hyun Kim1*

1Department of Clinical Laboratory Science, Semyung University, Jaecheon 27136, Republic of Korea
2Division of Crop Foundation, National Institute of Crop Science (NICS), Rural Development Administration (RDA), Wanju 55365, Republic of Korea

Correspondence to :
Sa-Hyun Kim,       science4us@semyung.ac.kr

Abstract

Go to

Helicobacter pylori (H. pylori) establishes infection in the human gastric mucosa for a long time and causes severe gastric diseases such as peptic ulcer and gastric cancer. When H. pylori is exposed to the antibacterial agents or inhibitors, the expression of pathogenic associated genes could be altered. In this study, we analyzed the transcriptional changes of H. pylori genes induced by zerumbone treatment. RNA expression changes were analyzed using next-generation sequencing (NGS), and then reverse transcription-polymerase chain reaction (RT-PCR) was performed to verify the results. As a result of NGS analysis, a total of 23 out of 1,632 genes were differentially expressed by zerumbone treatment. RT-PCR confirmed that zerumbone treatment regulated the expression level of 14 genes. Among the genes associated with DNA replication, transcription, virulence factors and T4SS components, 10 genes (dnaE, dnaQ, rpoA, rpoD, secA, flgE, flhA, virB5, virB8 and virB9) were significantly down-regulated and 4 genes (flaA, flaB, virB4 and virD4) were up-regulated. The results of our current study imply that zerumbone might be a potential therapeutic agent for H. pylori infection by regulating factors related to various H. pylori pathogenicity.

Keywords: Helicobacter pylori, zerumbone, next-generation sequencing, RNA-sequencing

Graphical Abstract


서론

Go to

Helicobacter pylori는 전 세계 인구의 절반 이상이 보균하고 있는 그람 음성 세균이다[1-3]. H. pylori는 수십 년 동안사람의 위 점막에 집락을 이루면서 지속적으로 감염을 일으킬 수 있으며, 수많은 연구들을 통해 위염, 소화성 궤양, 위암과 H. pylori 감염이 관련있다는 사실이 밝혀졌다[4-6]. 그러한 이유로 WHO에서는 1994년에 H. pylori를 제 1군 발암인자로 규정하였다[7]. 전세계 국가들 중 한국, 일본, 중국 등동아시아 국가에서 위암 발생률이 높은데, 다른 국가들에 비해 상대적으로 높은 H. pylori 보균율이 주요 원인으로 여겨진다[8]. 따라서 세계적으로 건강증진을 위해서는 H. pylori감염을 억제하기 위한 공동의 노력이 필요하다.

제럼본은 열대지방의 식물인 Zingiber zerumbet(샴푸 생강이라고도 함)의 주요 성분이다[9]. 제럼본이 다량 함유된뿌리줄기는 2세기 초부터 동남아시아에서 항염증 민간요법으로 사용되었다[10]. 제럼본은 항산화, 항염증, 항암 효과와 같은 여러가지 약리학적 효과를 가진 것으로 보고되고있다[11-13]. Vishwanatha 등은 연구를 통해 제럼본이 Staphylococcus epidermidis, Escherichia coli, Aspergillus oryza, A. niger에 대한 항균 활성을 가진다고 보고하였다[14]. Sidahmed 등은 H. pylori에 대한 제럼본의 항균 효과를 보고하였으나, 최소억제농도에 대한 결과만을 보고하였다[15]. 본 연구팀은 이전 연구에서 2차원 전기영동(2-DE) 분석을 통해 H. pylori에서 CagA를 포함한 독성 인자들의 단백질 발현에 대한 제럼본의 영향을 조사하였다[16]. 또한 제럼본이 H. pylori 생존에 필수적인 것으로 알려진 urease의 활성에 미치는 영향에 대해서도 조사하였다[17].

유전자 발현은 다양한 환경 자극에 따라 반응하여 변화하며 수많은 세포 기능을 조절한다. 따라서 mRNA의 발현을측정하는 것은 세포 기능에 대한 이해를 가능하게 한다. Next Generation Sequencing (NGS)은 대용량의 염기서열 정보를분석할 수 있는 방법으로 처음에는 유전체 염기서열 정보 확인에 주로 사용되었으나, 나중에는 전사체(transcriptome)의정보 등 다양한 영역으로 확장되어 오믹스(omics) 연구의 핵심 기술이 되었다[18]. NGS, 특히 RNA-sequencing (RNA-Seq) 기술은 다양한 샘플에서 RNA 전사체의 검출 및 정량화를 가능하게 한다. 본 연구에서는 최신 기법인 NGS에 기초한 RNA-Seq 기법과 기존에 널리 이용되고 있는 기법인RT-PCR을 사용하여 H. pylori의 다양한 병원성과 관련된 유전자 발현에 대한 제럼본의 영향을 비교 분석하였다.

재료 및 방법

Go to

시약 및 재료

본 연구에 사용된 H. pylori 표준균주(ATCC 49503)는American Type Cell Collection (ATCC, USA)에서 분양받아 실험에 사용하였다. H. pylori의 배양과 실험에는 Becton-Dickinson (USA)에서 구입한 Mueller-Hinton broth, Mueller-Hinton agar, Brucella agar를 사용하였다. Bovine serum은 Gibco (USA)에서 구입하였다. Zerumbone은Sigma-Aldrich (USA)에서 100% 에탄올에 100 mM 농도로용해하여 -70℃에서 보관한 뒤 실험에 사용하였다. RT-PCR에 사용한 Trizol reagent, random hexamer, Moloney Murine Leukemia Virus Reverse Transcriptase (MMLV-RT)는 Invitrogen (USA)에서 구입하였다.

세균 배양

H. pylori 표준균주는 10% bovine serum이 첨가된Brucella agar plate에 접종하여 3일간 100% 습도가 유지되는 미세산소환경에서 37℃ 배양한 후 실험에 사용하였다. 액체배지에서 배양하기 위하여 H. pylori 집락을 모아서 10%bovine serum이 첨가된 Mueller-Hinton broth에 McFarland scale 0.5로 맞추어 풀어준 뒤 100% 습도가 유지되는 미세산소환경에서 37℃, 3일간 배양하였다. 약물 비처리 대조군의 경우 최고 농도의 약물처리군에 들어가는 에탄올 용매와동일한 양의 에탄올을 처리하였다. 모든 약물처리실험은 동일한 배치의 H. pylori를 사용하였으며 동일한 실험을 3회반복적으로 수행하였다.

최소억제농도(MIC)

배양된 H. pylori 표준균주의 집락을 모아서 10% bovine serum이 첨가된 Mueller-Hinton broth에 McFarland scale 0.5로 맞추어 풀어준 뒤 다양한 농도로 제럼본을 처리하고100% 습도가 유지되는 미세산소환경에서 37℃, 3일간 배양하였다. 최소억제농도를 판정하기 위하여 분광광도계를 이용하여 600 nm의 파장으로 배양액의 흡광도를 측정하고 약물 비처리 대조군의 흡광도 값을 기준(100%)으로 하여 약물처리군의 세균 성장율을 퍼센트로 나타내었다.

차세대 염기서열 분석법(NGS)

Total RNA 2 µg으로부터 oligodT를 이용하여 mRNA를분리하였다. Library는 100 bp Paired-end sequencing을 위해 진행하였으며, 샘플 혼합 후 Illumina사의 TruSeq RNA Library Sample Prep Kit을 이용하여 Library를 준비하였다. 분리한 mRNA는 fragmentation 단계를 거치고 random hexamer priming을 통해 single-stranded cDNA로 합성하였다. 이를 주형으로 하여 second strand를 합성한 double stranded cDNA를 준비하였다. Blunt-end를 만들기 위한End Repair, Adapter를 붙이기 위해 A-tailing 및 Adapter ligation을 순차적으로 거친 후, 중합효소연쇄반응(PCR)을이용하여 cDNA library를 증폭하였다. 최종 산물은 2100 BioAnalyzer를 이용하여 확인하였고 만들어진 library는KAPA library quantification kit을 이용하여 정량한 후cluster generation하여 Hiseq2500을 이용하여 서열해독을진행하였다.

유전자 발현량 측정

발현량 측정은 Cufflinks v2.1.1를 이용하여 계산하였다[19]. 발현량 측정을 위해서 해당 종의 유전자 정보를 사용하였으며, non-coding 유전자 영역은 -mask 옵션을 이용하여 발현량 측정에서 제외하였다. 발현량 측정의 정확성을 높이기 위하여 multi-read-correction과 frag-bias-correct 옵션을 추가로 사용하였으며, 다른 옵션은 기본값으로 사용하였다.

특이발현 유전자 분석

특이발현 유전자 분석은 Cuffdiff를 이용하여 계산하였다[20]. 정확한 분석을 위해 multi-read-correction과 frag-bias-correct 옵션을 추가로 사용하였고, 특이발현 유전자선택은multiple-testing 과정에서 생기는 오류를 보정한 Q-value를기준으로 하였으며 0.05 미만을 기준값으로 하였다. 다른 옵션들은 기본값을 사용하여 진행하였다[21].

RT-PCR (reverse transcription-polymerase chain reaction)

배양된 H. pylori의 집락을 모아 PBS로 2회 세척한 후Trizol reagent를 이용하여 RNA를 추출하였다. 추출한 RNA의 농도를 측정하여 정량하였으며, RNA 2 ng을 random hexamer 0.25 μg, dNTP 10 nmole과 65℃에서 5분간 반응시킨 후 5X buffer 4 ml, DTT 200 mmole, MMLV-RT 200 unit을 첨가하여 25℃에서 10분, 37℃에서 50분, 70℃에서 15분간 반응하여 cDNA를 합성하였다. 합성한 cDNA를 이용하여 PCR을 수행하였으며, Primer에 대한 정보 및PCR 수행 조건은 Table 1에 요약하였다.

Table 1 . List of primer sequences and PCR conditions for RT-PCR.

PrimersSequences (5'-3')Product length (bp)Annealing temperature (℃)CyclesReference
ForwardReverse
DnaAGGGCATGACTTTAGCGGTTATTAACGAATTGCACGCCAAC1285527[37]
DnaBAATGGGCCGTTTATCGTCTCCAAATCCGCTTGCAACTACG2315527[37]
DnaEAATCCACCGGCTCCAAATACGCCAAACAAGTGTGGGAGTA1845527[37]
DnaNGTTAGCGGTGGTTGAAAACGCGGTTTCGCTATGCTCAGAA2335527[37]
DnaQCGCATGAAGCTTTGCAAGAAGCATAGGCTCTATGGCTGAC2445527[37]
HolBTGCAAGCCTTTTTGAACACCCGCGTTTTGGGCTTCTATAC1965526[37]
GyrAGTGCATAGGCGTATTTTCATTCTGGCTTCAGTGTAACG2465225[36]
RpoAAGCGACACGTCTTCAGTAACACAGCACCTTTGATCCCATC2245519[38]
RpoBTTTAGGTAAGCGCGTGGATTAATCAGCTTTGGATGGAACG3015921[38]
RpoDTCATCATCATTGCCGACTGGGTCATGCGCAAACACATTCA1525522[38]
RpoNGCCCTTGAAATCGTGCTTACATGATGAGAGCTACCCGACA2505524[38]
CagATGGCAGTGGGTTAGTCATACCTGTGAGTTGGTCTTCTTGT2784535[39]
VacAAAACGACAAGAAAGAGATCAGTCCAGCAAAAGGCCCATCAA2915722[40]
SecAAAAAATTTGACGCTGTGATCCCCCCCAAGCTCCTTAATTTC2744727[41]
FlaATAGACACCACCAACGCTAAATGCATTCTAGGGGGTTGTAT2396229[38]
FlaBGTCAATGGCGTGAATGATTAATTCACGGTCCCAATTTCTA2136029[38]
FlgECCGATCAAATCCTTAACACCAGGCTTAAAAACATGCGAAC3815229[38]
FlhATCATTGGAGGGTTTTTAGTGGGGTGCGAGTGGCGACAAT1556028[38]
VirB2CAGTCGCCTGACCTCTTTTGACGGTCACCAGTCCTGCAAC1566225[42]
VirB4GTTATAGGGGCAACCGGAAGTTGAACGCGTCATTCAAAGC4496237[42]
VirB5TACAAGCGTCTGTGAAGCAGGACCAACCAACAAGTGCTCA4366230[42]
VirB6CCTCAACACCGCCTTTGGTATAGCCGCTAGCAATCTGGTG2256225[42]
VirB7GATTACGCTCATAGGCGATGCTGGCTGACTTCCTTGCAACA2026225[42]
VirB8GTTGATCCTTGCGATCCCTCACGCCGCTGTAACGAGTATTG2186225[42]
VirB9GCATGTCCTCTAGTCGTTCCATATCGTAGATGCGCCTGACC2696225[42]
VirD4CCGCAAGTTTCCATAGTGTCGCGAGTTGGGAAACTGAAGA2636225[42]
GalEATGGCATTATTATTCACAGGGCTCCATAAGGATTAATGGG4615927[43]


통계분석

막대그래프 상에 나와있는 실험결과는 mean ± standard error of mean (SEM)로 표현하였다. 모든 실험의 통계처리는 GraphPad Prism 5.02 software (GraphPad Software, CA, USA)를 이용하였으며 unpaired Student’s t-test를 사용하여 유의성을 검증하였다(*p < 0.05, **p < 0.01 and ***p < 0.001).

결과 및 고찰

Go to

최소억제농도의 측정

H. pylori에 대한 제럼본의 최소억제농도를 구하기 위하여액체배지희석법을 사용하였다. 다양한 농도(0, 6.25, 12.5, 25, 50, 100, 200 μM)의 제럼본을 처리한 Mueller-Hinton broth를 준비하고 H. pylori 표준균주(ATCC 49503)를McFarland scale 0.5로 맞추어 풀어준 뒤 100% 습도가 유지되는 미세산소환경에서 37℃, 3일간 배양하였다. 액체배지희석법을 통한 실험 결과에서 H. pylori에 대한 제럼본의 최소억제농도는 100 μM으로 나타났다(Fig. 1). 최소억제농도보다 낮은 농도인 50 μM에서도 약간의 생장 억제가 나타났으므로 후속 실험에서는 H. pylori의 생장을 억제하지 않는안전한 농도인 20 μM을 최고농도로 사용하였다.

Figure 1.Minimum inhibitory concentration of zerumbone against H. pylori. H. pylori (ATCC 49503) was grown in the Mueller-Hinton broth containing the indicated concentration of zerumbone (0, 6.25, 12.5, 25, 50, 100 and 200 μM). After 72 h of incubation, a final optical density of the bacterial suspension was measured at 600 nm wavelength by spectrophotometry. Data are presented as the mean ± SEM. Results from triplicate experiments were analyzed by Student’s t-test (***p < 0.001).

NGS를 이용한 제럼본 처리 H. pylori의 전사체 변화 분석

제럼본 처리에 의한 전사체 변화를 분석하기 위하여 H. pylori 표준균주에 제럼본을 처리한 배지와 처리하지 않은 배지로부터 H. pylori의 RNA를 분리한 뒤 각각의 전사체를 분석하였다. 분석결과 총 1,632개의 유전자 중 이미 알려진유전자가 1076개이고 이중 23개의 유전자가 제럼본 처리에의해 유의하게 변화하는 특이발현 유전자로 분석되었다. 통계적으로 유의한 발현량의 변화를 시각적으로 잘 보여주는Volcano plot으로 NGS 분석 결과를 나타내었다(Fig. 2). 제럼본 처리에 의해 유의하게 변화한 23개의 유전자 중 16개는 하향 조절 유전자였고 나머지 7개는 상향 조절 유전자였다. H. pylori의 병리와 밀접한 연관이 있는 DNA 복제와 전사관련 인자, 주요 병원성 인자, Type IV secretion system (T4SS) 구성 인자들 중에서는 유전자 발현이 유의하게 감소한 유전자는 10개(dnaE, dnaQ, rpoA, rpoD, secA, flgE, flhA, virB5, virB8, virB9)였고, 유전자 발현이 유의하게 증가한 유전자는 5개(dnaB, flaA, flaB, virB4, virD4)였다(Table 2).

Table 2 . Summary of down-regulated genes associated with DNA replication, transcription, virulence factors and T4SS after treatment with zerumbone analyzed by NGS.

CategoryGeneNamea)LocusDescriptionGene expressionControl : Zerumbone ratio
ControlZerumbone
DNA replication & transcriptiondnaBHP_1198replicative DNA helicase (DnaB)1205.821507.641.25
dnaEHP_1460DNA polymerase III alpha-subunit (DnaE)662.42503.260.76
dnaQHP_0500DNA polymerase III epsilon subunit (DnaQ)261.75214.680.82
rpoAHP_1293DNA RNA polymerase, alpha subunit (RpoA)2854.812122.390.74
rpoDHP_0088RNA polymerase sigma-54 factor (RpoN)1415.061233.490.87
Virulence factorssecAHP_0786preprotein translocase subunit (SecA)380.11276.280.73
flaAHP_0601flagellin A (FlaA)1726.912188.701.27
flaBHP_0115flagellin B (FlaB)10.7112.591.18
flgEHP_0908flagellar hook (FlgE)166.12112.860.68
flhAHP_1041flagellar biosynthesis protein (FlhA)131.6998.510.75
T4SSvirB4HP_0017virB4 homolog (VirB4)168.62231.291.37
virB5HP_0539cag pathogenicity island protein (Cag18)33.6028.160.84
virB8HP_0530cag pathogenicity island protein (Cag10)423.43371.080.88
virB9HP_0528cag pathogenicity island protein (Cag8)104.2990.460.87
virD4HP_0524cag pathogenicity island protein (Cag5)51.4163.531.24

a)Gene designation of H. pylori strain was obtained according to the NCBI (http://www.ncbi.nlm.nih.gov/) and KEGG database (http://www.genome.jp/kegg/). b)The ratio of gene expression-change amount was calculated as follows: quantity of gene expression with caryophyllene treatment/quantity of gene expression without caryophyllene treatment.

Figure 2.The volcano plot depicting the fold differences in gene expression levels of H. pylori after zerumbone treatment. The volcano plot representation of differential expression analysis of genes in the untreated H. pylori versus zerumbonetreated H. pylori. The x-axis shows log2 fold changes in expression and the y-axis the log odds of a gene being differentially expressed. Red and blue points mark the genes with significantly increased or decreased expression respectively in untreated H. pylori compared to zerumbone-treated H. pylori.

제럼본에 의한 H. pylori DNA 복제와 전사 관련 유전자발현 변화

NGS를 이용한 분석에서 제럼본 처리에 의해 H. pylori의DNA 복제와 전사 관련 인자, 주요 병원성 인자, T4SS 구성인자들의 발현이 유의하게 감소 또는 증가하는 것으로 나타났다. 따라서 특정 유전자의 mRNA 발현 변화가 다른 분석법에서도 동일하게 변화하는지를 확인하기 위해 RT-PCR을수행하였다. 제럼본을 처리한 H. pylori와 처리하지 않은 H. pylori의 RNA를 추출한 뒤 RT-PCR로 H. pylori의 병리와밀접한 연관이 있는 유전자들의 발현을 확인하였다. 가장 먼저 DNA 복제와 전사관련 유전자의 발현을 RT-PCR로 분석하였다. 그 결과 제럼본을 처리한 H. pylori에서는 dnaE, dnaQ, rpoA, rpoD mRNA의 발현 감소가 나타났다(Fig. 3, 4). 발현이 감소한 4개의 유전자는 NGS 분석결과와 동일하였으나 NGS 분석에서 발현이 증가했던 dnaB는 RT-PCR 분석에서는 유의한 발현량의 변화를 보이지 않았다. RT-PCR분석에서 제럼본 농도 의존적인 발현량 증가 경향성이 나타났지만 제럼본 20 μM 처리군의 p value가 0.537으로 통계학적으로 유의미한 변화는 아니었다. dnaE, dnaQ, rpoA, rpoD 유전자의 발현은 제럼본 농도의존적으로 유의미하게감소하였다. DNA 복제와 전사는 H. pylori를 포함한 모든 살아있는 생명체의 생존에 매우 중요한 과정이다. DnaE와DnaQ는 DNA polymerase III holoenzyme protein의 구성요소들이고 RpoA와 RpoD는 DNA를 RNA로 전사하는데 필요한 RNA polymerase의 구성요소들이다[22-24]. 그렇기 때문에 dnaE, dnaQ, rpoA, rpoD 유전자의 하향 조절은 제럼본 처리에 의한 H. pylori 성장 억제기전 중 하나가 될 수 있음을 시사한다.

Figure 3.mRNA expression levels of DNA replication-related genes in zerumbone treatment conditions. H. pylori specimens were cultured with indicated concentrations of zerumbone in Mueller-Hinton broth for 72 h and RNA was extracted. (A) Expression of DNA replication machineries (dnaB, dnaE, dnaN, dnaQ, holB and gyrA) in H. pylori treated with zerumbone. Constitutively expressed galE was used as an internal control. (B) Densities of the PCR bands were illustrated as a graph and the data in the bar graphs are presented as mean ± standard error of the mean (SEM) of triplicate experiments were analyzed by Student’s t-test (*p < 0.05).

Figure 4.mRNA expression levels of transcription genes in zerumbone treatment conditions. H. pylori specimens were cultured with indicated concentrations of zerumbone in Mueller- Hinton broth for 72 h and RNA was extracted. (A) Expression of transcription machineries (rpoA, rpoB, rpoD and rpoN) in H. pylori treated with zerumbone. Constitutively expressed galE was used as an internal control. (B) Densities of the PCR bands were illustrated as a graph and the data in the bar graphs are presented as mean ± standard error of the mean (SEM) of triplicate experiments were analyzed by Student’s t-test (*p < 0.05 and **p < 0.01).

제럼본에 의한 H. pylori 병원성 인자의 발현 변화

H. pylori의 병원성 인자에는 많은 것들이 있지만 그 중에서도 CagA와 VacA가 가장 대표적이다. CagA 단백질과VacA 단백질은 숙주 세포의 세포 내 신호 전달을 방해하여세포의 통제되지 않은 성장과 염증 반응을 유발하는 것으로알려져 있다[1-3, 25]. SecA 단백질은 Type Va secretion system (T5aSS)의 조절을 담당하는 ATPase이며, VacA 단백질은 T5aSS에 의해 분비된다[6, 26, 27]. 제럼본으로 처리한 H. pylori의 cagA, vacA, secA 유전자의 mRNA 발현 정도도 RT-PCR을 이용하여 분석하고 NGS 결과와 비교 확인하였다. RT-PCR 분석에서 제럼본 농도의존적으로 secA 유전자의 발현이 감소되었고 이는 NGS와 일치하는 결과였다(Fig. 5). H. pylori는 위 점막에서 집락을 형성하고 병리학적변화를 유도하는 데 필요한 다양한 독성 인자를 가지고 있다. 그 중 편모는 세균이 집락을 형성하기 위해 위 상피 쪽으로 이동하는데 꼭 필요한 구조이다. FlaA와 FlaB는 편모의 필라멘트 구조를 구성하는 편모 단백질 중 가장 대표적인 구성 성분이다[28, 29]. FlgE는 편모 필라멘트를 기저체에 연결하는 역할을 하고 FlhA는 플라젤린 단백질의 발현을조절한다[5, 30]. NGS 결과와 마찬가지로 RT-PCR 분석에서도 동일하게 flaA와 flaB 유전자의 발현은 증가하고, flgE와 flhA 유전자의 발현은 감소하였다(Fig. 5). 제럼본 처리에의한 H. pylori의 주요 병원성 인자인 VacA 분비를 조절하는 secA 유전자의 하향 조절과 더불어 편모의 생성과 기능에 관여하는 flgE와 flhA 유전자의 하향 조절은 위 점막에서H. pylori 감염력을 낮추는데 기여할 수 있음을 시사한다.

Figure 5.mRNA expression levels of virulence factors in zerumbone treatment conditions. H. pylori specimens were cultured with indicated concentrations of zerumbone in Mueller-Hinton broth for 72 h and RNA was extracted. (A) Expression of major virulence factors (cagA, vacA and secA) and flagella components (flaA, flaB, flgE and flhA) in H. pylori treated with zerumbone. Constitutively expressed galE was used as an internal control. (B) Densities of the PCR bands were illustrated as a graph and the data in the bar graphs are presented as mean ± standard error of the mean (SEM) of triplicate experiments were analyzed by Student’s t-test (*p < 0.05 and **p < 0.01).

제럼본에 의한 H. pylori T4SS 구성 인자의 발현 변화

T4SS는 CagA 단백질이 숙주 세포로 전달하는데 이용하는 H. pylori의 단백질 분비 시스템 중 하나이다[31]. T4SS는 일반적으로 11개의 VirB 단백질로 구성되어 있으며, VirB1-B11 유전자와 VirD4 단백질에 의해 암호화된다고 알려져있다[31, 32]. 앞선 NGS 분석에서 제럼본 처리에 의해virB4, virB5, virB8, virB9, virD4 유전자 발현이 변화하였고 RT-PCR을 통해 이를 다시 확인해보았다. RT-PCR을 수행한 결과, H. pylori에서 제럼본 처리에 의해 virB5, virB8, virB9의 mRNA 발현량의 감소가 농도의존적으로 나타났고virB4와 virD4의 mRNA 발현량의 증가 또한 제럼본 농도의존적으로 나타났다(Fig. 6). VirB4와 VirD4 단백질은 CagA분비 및 T4SS 조립에 필요한 에너지를 제공하는 막 내부의ATPase이다[33]. VirB5는 VirB2와 함께 T4SS의 external pilus를 구성하는 요소이고 VirB8은 세포질 내막 복합체의구성요소이다[33-35]. VirB9는 VirB7, VirB10과 함께 막 통과 채널을 구성한다[36]. 제럼본 처리에 의해 T4SS 유전자들의 발현이 변화하고 그로 인해 T4SS이 정상적인 기능을하지 못하게 된다면 H. pylori의 주요 병원성 인자인 CagA를 숙주세포로 전달시키는데 어려움을 겪게 될 것이라 사료된다. 결론적으로, 제럼본은 H. pylori의 다양한 병원성 인자들의 발현을 대부분 감소시켰으며 일부는 증가시킴으로써 mRNA의 유의미한 변화를 야기하였다. H. pylori의 DNA 복제와 전사 관련 인자, 주요 병원성 인자, T4SS 구성 인자들과 관련된 유전자 중 제럼본 처리에 의해 유의미하게 변화한 15개 유전자 가운데 한 개의 유전자를 제외하고는 NGS와 RT-PCR에서 동일한 결과를 확인할 수 있었다. 본 연구의 결과들을 종합해보면 제럼본이 H. pylori를 제균하기 위한 치료제 또는 H. pylori 감염 억제제로 사용될 수 있음을시사한다.

Figure 6.mRNA expression levels of T4SS components in zerumbone treatment conditions. H. pylori specimens were cultured with indicated concentrations of zerumbone in Mueller-Hinton broth for 72 h and RNA was extracted. (A) Expression of T4SS components (virB2, virB4, virB5, virB6, virB7, virB8, virB9 and virD4) in H. pylori treated with zerumbone. Constitutively expressed galE was used as an internal control. (B) Densities of the PCR bands were illustrated as a graph and the data in the bar graphs are presented as mean ± standard error of the mean (SEM) of triplicate experiments were analyzed by Student’s t-test (*p < 0.05 and **p < 0.01).

요약

Go to

본 연구에서는 제럼본에 처리에 의해 유도된 H. pylori 유전자의 전사적 변화를 분석하였다. NGS를 사용하여 RNA발현 변화를 분석한 다음 그 결과를 검증하기 위해 RT-PCR을 수행하였다. NGS 분석 결과, 1,632개의 유전자 중 총23개가 제럼본 처리에 의해 유의하게 발현이 변화된 특이발현 유전자로 분석되었다. DNA 복제와 전사, 병원성 인자 및T4SS 성분과 관련된 유전자 중 10개는 현저하게 하향 조절되었고 5개는 상향 조절되었다. RT-PCR을 이용하여 유전자의 발현 수준을 재확인하였고 그 결과, 14개 유전자에서 NGS와 동일하게 발현 양상이 변화하였다. RT-PCR은 제럼본 처리에 의해 10개의 유전자(dnaE, dnaQ, rpoA, rpoD, secA, flgE, flhA, virB5, virB8, virB9)의 발현 감소와 4개의 유전자(flaA, flaB, virB4, virD4)의 발현 증가를 보였다. 이러한본 연구의 결과는 제럼본이 다양한 H. pylori의 병원성과 관련된 인자들을 조절함으로써 H. pylori 감염의 잠재적인 치료제가 될 수 있음을 시사한다.

Acknowledgment

Go to

This paper was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (Ministry of Sciences and ICT) (No. 2019R1G1A1100451).

Conflict of Interest

Go to

The authors have no financial conflicts of interest to declare.

References

Go to
  1. de Martel C, Ferlay J, Franceschi S, Vignat J, Bray F, Forman D, et al. 2012. Global burden of cancers attributable to infections in 2008: a review and synthetic analysis. Lancet Oncol. 13: 607-615.
    Pubmed CrossRef
  2. Marshall BJ, Warren JR. 1984. Unidentified curved bacilli in the stomach of patients with gastritis and peptic ulceration. Lancet 1: 1311-1315.
    Pubmed CrossRef
  3. Warren JR, Marshall B. 1983. Unidentified curved bacilli on gastric epithelium in active chronic gastritis. Lancet 1: 1273-1275.
    Pubmed CrossRef
  4. Amieva M, Peek RM Jr. 2016. Pathobiology of Helicobacter pylori-induced gastric cancer. Gastroenterology 150: 64-78.
    Pubmed KoreaMed CrossRef
  5. Salama NR, Hartung ML, Muller A. 2013. Life in the human stomach: persistence strategies of the bacterial pathogen Helicobacter pylori. Nat. Rev. Microbiol. 11: 385-399.
    Pubmed KoreaMed CrossRef
  6. Wang F, Meng W, Wang B, Qiao L. 2014. Helicobacter pyloriinduced gastric inflammation and gastric cancer. Cancer Lett. 345: 196-202.
    Pubmed CrossRef
  7. 1994. Schistosomes, liver flukes and Helicobacter pylori. IARC working group on the evaluation of carcinogenic risks to humans. lyon, 7-14 June 1994. IARC Monogr. Eval. Carcinog. Risks Hum. 61: 1-241.
    Pubmed KoreaMed
  8. Vilaichone RK, Mahachai V, Shiota S, Uchida T, Ratanachu-ek T, Tshering L, et al. 2013. Extremely high prevalence of Helicobacter pylori infection in bhutan. World J. Gastroenterol. 19: 2806-2810.
    Pubmed KoreaMed CrossRef
  9. Kalantari K, Moniri M, Boroumand Moghaddam A, Abdul Rahim R, Bin Ariff A, Izadiyan Z, et al. 2017. A review of the biomedical applications of zerumbone and the techniques for its extraction from ginger rhizomes. Molecules 22: 1645.
    Pubmed KoreaMed CrossRef
  10. Ohnishi K, Irie K, Murakami A. 2009. In vitro covalent binding proteins of zerumbone, a chemopreventive food factor. Biosci. Biotechnol. Biochem. 73: 1905-1907.
    Pubmed CrossRef
  11. Girisa S, Shabnam B, Monisha J, Fan L, Halim CE, Arfuso F, et al. 2019. Potential of zerumbone as an anti-cancer agent. Molecules 24: 734.
    Pubmed KoreaMed CrossRef
  12. Rosa A, Caprioglio D, Isola R, Nieddu M, Appendino G, Falchi AM. 2019. Dietary zerumbone from shampoo ginger: new insights into its antioxidant and anticancer activity. Food Funct. 10: 1629-1642.
    Pubmed CrossRef
  13. Sulaiman MR, Perimal EK, Akhtar MN, Mohamad AS, Khalid MH, Tasrip NA, et al. 2010. Anti-inflammatory effect of zerumbone on acute and chronic inflammation models in mice. Fitoterapia 81: 855-858.
    Pubmed CrossRef
  14. Vishwanatha H, Babu PN, Gowrishankar B, Shridhar S. 2012. Antimicrobial activity of zerumbone from zingiber zurumbet against Staphylococcus epidermidis and Aspergillus spp. Int. J. Appl. Biol. Pharm. 3: 40-43.
  15. Sidahmed HMA, Hashim NM, Abdulla MA, Ali HM, Mohan S, Abdelwahab SI, et al. 2015. Antisecretory, gastroprotective, antioxidant and anti-Helicobcter pylori activity of zerumbone from Zingiber zerumbet (L.) Smith. PLoS One 10: e0121060.
    Pubmed KoreaMed CrossRef
  16. Kim S-H. 2018. Comparative proteome analysis of zerumbonetreated Helicobacter pylori. Korean J. Clin. Lab. Sci. 50: 275-283.
    CrossRef
  17. Woo HJ, Yang JY, Lee P, Kim JB, Kim SH. 2021. Zerumbone inhibits Helicobacter pylori urease activity. Molecules 26: 2663.
    Pubmed KoreaMed CrossRef
  18. Choe D, Palsson B, Cho BK. 2020. STATR: A simple analysis pipeline of Ribo-Seq in bacteria. J. Microbiol. 58: 217-226.
    Pubmed KoreaMed CrossRef
  19. Trapnell C, Williams BA, Pertea G, Mortazavi A, Kwan G, van Baren MJ, et al. 2010. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 28: 511-515.
    Pubmed KoreaMed CrossRef
  20. Trapnell C, Roberts A, Goff L, Pertea G, Kim D, Kelley DR, et al. 2012. Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat. Protoc. 7: 562-578.
    Pubmed KoreaMed CrossRef
  21. Benjamini Y, Hochberg Y. 1995. Controlling the false discovery rate: a practical and powerful approach to multiple testing. J. Royal Stat. Soc.: Series B (Methodological) 57: 289-300.
    CrossRef
  22. Campbell EA, Korzheva N, Mustaev A, Murakami K, Nair S, Goldfarb A, et al. 2001. Structural mechanism for rifampicin inhibition of bacterial rna polymerase. Cell 104: 901-912.
    Pubmed CrossRef
  23. Dailidiene D, Tan S, Ogura K, Zhang M, Lee AH, Severinov K, et al. 2007. Urea sensitization caused by separation of Helicobacter pylori RNA polymerase beta and beta' subunits. Helicobacter 12: 103-111.
    Pubmed CrossRef
  24. Nitharwal RG, Verma V, Dasgupta S, Dhar SK. 2011. Helicobacter pylori chromosomal DNA replication: current status and future perspectives. FEBS Lett. 585: 7-17.
    Pubmed CrossRef
  25. Goh KL, Chan WK, Shiota S, Yamaoka Y. 2011. Epidemiology of Helicobacter pylori infection and public health implications. Helicobacter 16 Suppl 1: 1-9.
    Pubmed KoreaMed CrossRef
  26. Boquet P, Ricci V. 2012. Intoxication strategy of Helicobacter pylori VacA toxin. Trends Microbiol. 20: 165-174.
    Pubmed CrossRef
  27. Fan E, Chauhan N, Udatha DB, Leo JC, Linke D. 2016. Type V secretion systems in bacteria. Microbiol. Spectr. 4. doi: 10.1128/microbiolspec.VMBF-0009-2015.
    Pubmed CrossRef
  28. Allan E, Dorrell N, Foynes S, Anyim M, Wren BW. 2000. Mutational analysis of genes encoding the early flagellar components of Helicobacter pylori: evidence for transcriptional regulation of flagellin A biosynthesis. J. Bacteriol. 182: 5274-5277.
    Pubmed KoreaMed CrossRef
  29. Schirm M, Soo EC, Aubry AJ, Austin J, Thibault P, Logan SM. 2003. Structural, genetic and functional characterization of the flagellin glycosylation process in Helicobacter pylori. Mol. Microbiol. 48: 1579-1592.
    Pubmed CrossRef
  30. Tsang J, Hoover TR. 2015. Basal body structures differentially affect transcription of RpoN- and FliA-dependent flagellar genes in Helicobacter pylori. J. Bacteriol. 197: 1921-1930.
    Pubmed KoreaMed CrossRef
  31. Kwok T, Zabler D, Urman S, Rohde M, Hartig R, Wessler S, et al. 2007. Helicobacter exploits integrin for type IV secretion and kinase activation. Nature 449: 862-866.
    Pubmed CrossRef
  32. Merino E, Flores-Encarnacion M, Aguilar-Gutierrez GR. 2017. Functional interaction and structural characteristics of unique components of Helicobacter pylori T4SS. FEBS J. 284: 3540-3549.
    Pubmed CrossRef
  33. Terradot L, Waksman G. 2011. Architecture of the Helicobacter pylori cag-type IV secretion system. FEBS J. 278: 1213-1222.
    Pubmed CrossRef
  34. Olbermann P, Josenhans C, Moodley Y, Uhr M, Stamer C, Vauterin M, et al. 2010. A global overview of the genetic and functional diversity in the Helicobacter pylori cag pathogenicity island. PLoS Genet. 6: e1001069.
    Pubmed KoreaMed CrossRef
  35. Woo HJ, Yang JY, Kwon HJ, Kim HW, Kim S-H, Kim J-B. 2021. Comparative transcriptome analysis of caryophyllene-treated Helicobacter pylori. Microbiol. Biotechnol. Lett. 49: 440-448.
    CrossRef
  36. Woo HJ, Yang JY, Lee MH, Kim HW, Kwon HJ, Park M, et al. 2020. Inhibitory effects of β-caryophyllene on Helicobacter pylori infection in vitro and in vivo. Int. J. Mol. Sci. 21: 1008.
    Pubmed KoreaMed CrossRef
  37. Kwon HJ, Lee MH, Kim HW, Yang JY, Woo HJ, Park M, et al. 2020. Riboflavin inhibits growth of Helicobacter pylori by down-regulation of polA and dnaB genes. Biomed. Sci. Lett. 26: 288-295.
    CrossRef
  38. Tharmalingam N, Kim SH, Park M, Woo HJ, Kim HW, Yang JY, et al. 2014. Inhibitory effect of piperine on Helicobacter pylori growth and adhesion to gastric adenocarcinoma cells. Infect. Agent Cancer. 9: 43.
    Pubmed KoreaMed CrossRef
  39. Boonjakuakul JK, Canfield DR, Solnick JV. 2005. Comparison of Helicobacter pylori virulence gene expression in vitro and in the rhesus macaque. Infect. Immun. 73: 4895-4904.
    Pubmed KoreaMed CrossRef
  40. Niehues M, Stark T, Keller D, Hofmann T, Hensel A. 2011. Antiadhesion as a functional concept for prevention of pathogens: N-Phenylpropenoyl-L-amino acid amides as inhibitors of the Helicobacter pylori BabA outer membrane protein. Mol. Nutr. Food Res. 55: 1104-1117.
    Pubmed CrossRef
  41. Kim SH, Park M, Woo H, Tharmalingam N, Lee G, Rhee KJ, et al. 2012. Inhibitory effects of anthocyanins on secretion of Helicobacter pylori CagA and VacA toxins. Int. J. Med. Sci. 9: 838-842.
    Pubmed KoreaMed CrossRef
  42. Kim SH, Lee MH, Park M, Woo HJ, Kim YS, Tharmalingam N, et al. 2018. Regulatory effects of black rice extract on Helicobacter pylori infection‐induced apoptosis. Mol. Nutr Food Res. 62: 1700586.
    Pubmed CrossRef
  43. Lee MH Woo HJ, Park M, Moon C, Eom YB, Kim SH, Kim JB. 2016. Plumbagin inhibits expression of virulence factors and growth of Helicobacter pylori. Microbiol. Biotechnol. Lett. 44: 218-226.
    CrossRef

Article Tools

Starts of Metrics

Share this article on :

  • mail

Related articles in MBL

Most KeyWord ?

What is Most Keyword?

  • It is most registrated keyword in articles at this journal during for 2 years.