Contact us
닫기
Article Search
닫기

Microbiology and Biotechnology Letters

총설(Review)

View PDF

Environmental Microbiology (EM)  |  Microbial Ecology and Diversity

Microbiol. Biotechnol. Lett. 2022; 50(2): 165-192

https://doi.org/10.48022/mbl.2112.12005

Received: December 27, 2021; Revised: February 8, 2022; Accepted: March 4, 2022

대기 입자상물질의 미생물 메타게놈: 분석 방법, 특성 및 영향 인자

Microbial Metagenome of Airborne Particulate Matter: Methodology, Characteristics, and Influencing Parameters

Sookyung Kang and Kyung-Suk Cho*

Department of Environmental Science and Engineering, Ewha Womans University, Seoul 03760, Republic of Korea

Correspondence to :
Kyung Suk Cho,       kscho@ewha.ac.kr

Abstract

Go to

The microbial metagenome characteristics of bioaerosols and particulate matter (PM) in the outdoor atmospheric environment and the effects of climate and environmental factors on the metagenome were analyzed. The concentrations of bacteria and fungi in bioaerosols and PM were determined by sampling different regions with different environmental properties. A variety of culture-independent methods were used to analyze the microbial metagenome in aerosols and PM samples. In addition, the effects of meteorological and environmental factors on the diversity and metagenomes of bacteria and fungi were investigated. The survival, growth, and dispersal of the microorganisms in the atmosphere were markedly affected by local weather conditions and the air pollutant concentration. The concentration of airborne microorganisms increased as the temperature increased, but their concentration decreased in summer, due to the effects of high temperatures and strong ultraviolet rays. Humidity and microbial concentration were positively correlated, but when the humidity was too high, the dispersion of airborne microorganisms was inhibited. These comprehensive data on the microbial metagenome in bioaerosols and PM may be used to understand the roles and functions of microorganisms in the atmosphere, and to develop strategies and abatement techniques to address the environmental and public health problems caused by these microorganisms.

Keywords: Airborne microorganism, particulate matter, metagenome, culture-independent methodology

Graphical Abstract


서론

Go to

대기 미생물(Airborne microorganisms, AM)은 공기 중어디에나 존재하며 대부분 입자상물질(particulate matter, PM)에 부착된 형태로 존재한다. 최근 들어 PM에 의한 대기질 저하 및 이로 인한 건강 위협 문제가 심화됨에 따라, PM과 더불어 PM에 부착되어 있는 AM에 대한 연구가 많이 진행되고 있다[1-4]. PM을 구성하고 있는 중요한 부분인 AM은 인간의 건강, 대기 화학, 핵 생성(nucleation) 및 생태계상호 작용에 영향을 미치며, 해양, 대기 및 육상 환경 사이에서 생지화학적 순환을 하고 있다[5]. 그러므로 AM에 대한이해는 과학적, 위생학적 및 경제적 측면에서 중요하고, 이에 따라 AM 개개의 특성, 군집 다양성, 군집 내에서의 종류별 우점도 및 미생물의 시간적, 공간적 변동성 등에 대한 연구들이 근래 활발하게 진행되고 있다[1-4]. 과거에는 대기에서 채취한 전체 시료를 대상으로 미생물 군집 구조와 특성을 조사하였다. 그런데 PM의 입자 크기별로 인체에 미치는위해성에 차이가 있기 때문에, 최근에는 PM의 입자 크기에따른 미생물 군집 구조와 특성에 관한 연구도 진행되고 있다[1-4, 6].

바이오에어로졸 혹은 PM 시료의 미생물 분석을 위해 배양을 기반으로 하는 방법부터 비배양 방법인 분자생물학적기술을 이용하여, 세균, 곰팡이, 바이러스, 고세균 등과 같은미생물의 종류와 농도, 크기 분포 및 다양성 등에 관한 연구가 진행되었다[1-4]. 또한, AM 농도 및 종 다양성에 미치는기후적 인자와 대기오염물질의 영향에 대한 연구 결과도 보고되고 있다[3, 4].

본 논문에서는 실외 대기 환경의 바이오에어로졸 혹은 PM시료의 세균과 곰팡이 농도를 분석한 결과를 정리하였다. 또한 이들 시료를 비배양 의존 방법으로 AM의 군집 특성을 조사한 선행 연구결과를 취합하고 분석하여, AM의 메타게놈분석 방법 및 메타게놈 특성을 정리하였다. 또한, AM 군집구조와 농도에 영향을 미치는 핵심 인자인 기후적 요인과 대기오염물질의 영향을 종합적으로 고찰하였다. 이러한 종합적인 고찰 결과는 대기권에서 미생물의 역할과 기능을 이해하고, 이들 미생물에 의해 야기되는 환경 및 공중보건 문제를 해결하기 위한 전략 수립 및 저감 기술 개발에 활용될 수있다.

AM의 일반적인 특성 및 발생원

Go to

미생물은 너무 작아서 육안으로는 관찰 할 수 없는 생물로, 바이러스, 세균, 곰팡이, 미세조류 및 원생동물로 구분된다. 이 중 대기 환경에 서식하는 미생물인 AM은 주로 세균, 곰팡이 및 바이러스이다[7]. 물 환경이나 토양 환경과는 달리대기 환경은 높은 일사량, 낮은 수분과 영양소, 큰 분산 능력으로 미생물 생존에는 가혹한 조건이지만, 미생물은 대기환경에 적응하도록 진화되어 왔고, 현재 공기 중에 많은 양의 미생물이 존재하고 있다[8]. 기후적 특성과 대기오염 정도에 따라 AM의 조성은 매우 상이하지만, 일반적으로 세균이 약 80% 정도로 가장 많고, 그 다음 곰팡이가 많은 경향이 있다[3].

AM의 주요 발생원과 대기 중 외부 인자의 상호작용을 Fig. 1에 도시하였다[1, 2]. 미생물은 육상, 토양, 산림, 사막 먼지,농업 활동, 도시 지역, 습지, 해안 및 해양 환경에서 대기 중으로 배출된다[9, 10]. 또한, 폐수처리장, 매립지, 퇴비화 설비, 축산단지 등에서도 미생물이 대기 중으로 방출된다[11].입자 재부유 과정 이론에 기초하여 지상의 미생물이 대기 중으로 방출되므로[12], 지표면의 세균 농도와 지표면 근처 대기 중 세균 농도 사이에는 밀접한 상관관계가 있었다[13]. 사막과 산림 등의 자연생태기반 대륙, 인구 밀집 지역 및 해양에서 총입자상물질 중 생물학적 물질이 차지하는 비율(부피기준)은 각각 28%, 22% 및 10%로 추정되고 있다[14]. 또한, 1차 에어로졸 질량의 16-80%가 생물학적 발생원 유래인 것으로 추정되고 있다[10].

Figure 1.Sources of airborne microorganisms and their effect on physiochemical processes in atmosphere [1, 3].

미생물은 개별 세포로 대기 중에 존재하거나 토양 먼지,잎 조각, 포자 또는 기타 미생물 등의 다른 입자와 결합될 수있다[15-17]. 미생물은 에어로졸화되면 대류 공기 이동에 의해 위쪽으로 이동할 수 있으며 크기가 작기 때문에 상당한기간 동안 대기 중에 남아 있을 수 있다. 예를 들면 사막과가뭄 피해 지역에서 발생한 바이오에어로졸의 대륙간 이동이 관찰되었다[18]. 바이오에어로졸은 이동하면서 다른 발생원 유래의 미생물이 축적되기 때문에 바이오에어로졸을 구성하는 미생물 종류가 다양해진다[19]. 정상적인 바람 패턴에 의한 장거리 수송은 AM의 군집 구성에 영향을 준다[20].또한, 폭풍 등과 같은 강한 바람은 대기 중 미생물의 장거리이동에 기여한다[21].

대기 중으로 유입된 AM의 생존은 1차 운반체인 PM에 주로 의존하게 되는데, AM은 PM에 부착하여 군집을 형성하고 생명을 유지한다. PM에 부착된 유기물질 및 무기물질은AM의 생존에 필요한 영양소로 활용되어, AM의 기아를 예방하고 신진대사를 유지할 수 있다[22]. 또한, PM은 AM에게 보호막을 제공하여, 자외선에 의한 피해를 줄여줄 수 있다[22]. PM에 부착하지 않고 공기 중에 존재하는 AM은 PM부착 AM에 비해 생존 가능성이 낮은 것으로 알려져 있다. PM에 부착된 AM은 다양한 생물종으로 구성되고, AM 사이의 상호작용 및 외부인자와의 작용/반작용 등에 의해 다양해지면서 군집을 점차적으로 형성해 간다[23].

대기 환경에서 AM은 중요한 역할을 담당하는데[11, 24], AM은 대기의 물리적 및 화학적 과정에 기여하며[25], 시간에 따른 대기 중 세균의 군집 변화와 대기의 물리적, 화학적특성 사이에 강한 상관관계가 있다고 보고되었다[26]. Ariya and Amyot (2004)는 AM의 분해작용에 의해 대기 중 유기화합물의 화학적 조성이 변화될 수 있다고 보고하였다[27].또한, 바이오에어로졸은 주변 입자에 부착될 수 있고, 강수량을 유발할 수 있는 구름 응결핵 및 얼음핵으로 작용하여기후에 상당한 영향을 미칠 수 있음이 입증되었다[28]. Pratt et al. (2009)은 구름 응결핵과 얼음핵에 있는 얼음 결정 잔류물의 약 33%가 생물학적 입자라고 보고하였다[29].

AM은 ‘건식’ 혹은 ‘습식’ 침적에 의해 대기에서 제거된다[30]. 건식 침적은 건물, 식물, 수면, 지면 및 공기와 접촉하는 기타 표면에 대한 부착 등에 의해 일어난다[12, 30]. 습식침적은 비, 눈 또는 우박의 강수에 의해 일어난다[30, 31]. 이러한 AM은 흡입, 피부 노출 및 섭취 과정을 통해 인체에 유입되어 피부 알레르기, 호흡기 감염, 소화기 감염, 요로 감염, 심혈관 질환 및 만성 폐 질환 등의 문제를 야기시킬 수있다[32, 33].

대기 환경 중 세균과 곰팡이 개체수

Go to

대기 환경은 미생물 생육에는 혹독한 환경이지만, 상당량의 미생물이 존재한다. 대기 환경으로부터 에어로졸과 PM시료를 채취하여 배양법 혹은 비배양법으로 세균의 개체수를 측정한 결과를 Table 1에 정리하였다. 이란과 중국의 도심에서 채취한 에어로졸 혹은 PM 시료 중의 세균 수를, 세균 증식용 배지를 이용한 배양법으로 측정한 결과 101-103 cells/m3 수준이었다[34-36]. 연무가 없는 날(5.00×102-6.30 × 102 cells/m3)에 비해 연무가 낀 날의 에어로졸 중 세균 수(1.10 × 103-1.74 × 103 cells/m3)가 더 많았다[35]. Ji et al. (2019)은 cytometry를 이용하여 PM2.5 시료 중 세균 개체수를 측정한 결과, 대기오염이 거의 없는 날은 0.68 × 106 cells/m3이었으나, 대기오염도가 증가함에 따라 세균 개체수도 증가하였고, 대기오염이 심한 경우에 세균 개체수는2.32 × 106 cells/m3이었다[38]. 형광현미경을 이용하여 에어로졸 혹은 PM 시료를 대상으로 세균 개체수를 측정한 결과는 시료 채취 지역 및 환경 여건에 따라 약간 상이하지만 평균 105-106 cells/m3 수준이었다[19, 21, 39-46]. 미국의 산에서 채취한 에어로졸을 이용하여 분석한 세균 개체수는 103-105 cells/m3으로[40], 도시 및 산업지역의 대기보다는 적은수의 세균이 존재함을 알 수 있었다[39, 43-46]. 대류권 세균 개체수는 고도 800 m에서는 18.40 ± 3.20 × 106 cells/m3이었으나, 고도 3000 m에서는 2.28 ± 0.83 × 106 cells/m3로, 고도가 증가함에 따라 세균 개체수가 감소하였다[19]. Bai et al. (2021)도 중국의 도심에서 고도에 따라 세균 개체수를측정한 결과, 고도 1.5 m에 (0.73-1.52×105 cells/m3) 비해고도 229.5 m에서 (0.69-0.97 × 105 cells/m3) 세균 개체수가약간 적음을 보고하였다[46]. Li et al. (2015)의 결과와 유사하게, 맑은 날에 비해 연무 혹은 안개가 낀 날의 대기 중 세균 개체수가 많았다[35, 41].

Table 1 . Comparison of airborne bacterial concentration.

Sampling siteSample typeMethodBacterial concentration (cells/m3)Ref.
CountryLocation
IranUrbanPM2.5, PM10Culture-dependent6.21×102 (1.86×10 -2.10×103)[34]
ChinaUrbanAerosolCulture-dependent5.00×102 – 6.30×102 on non-hazy days
1.10×103 – 1.74×103 on hazy days		[35]
ChinaUrbanAerosolCulture-dependent2.01×102 (<12 – 3.26 ×103)[36]
ChinaUrbanPM2.5Culture-dependent1.11×103 (8.00×103 – 5.80×103)[37]
ChinaUrbanPM2.5Cytometry0.68×106 on non-pollution days
1.01×106 on low pollution days
1.48×106 on middle pollution days
2.32×106 on heavy pollution days		[38]
USASuburban, agricultural field, forestAerosolMicroscopy105-106[39]
USAMountainAerosolMicroscopy103-105[40]
JapanTroposphereAerosolMicroscopy18.40±3.20×106 at 800 m
2.28±0.83×106 at 3000 m		[19]
ChinaCoastal regionAerosolMicroscopy6.55×105 on non-hazy days
7.09×105 on hazy days
9.00×105 on foggy days		[41]
JapanSeaside siteAerosolMicroscopy105-106[42]
GreeceUrbanAerosolMicroscopyMax. 4.10×105[43]
ChinaUrbanPM2.5, PM10, TSPMicroscopy7.70×104 – 1.60×107[44]
ChinaIndustrial regionPM2.5
PM10		Microscopy
Microscopy		0.90 ×106 (0.05-3.37×106)
1.86 ×106 (0.17-5.73×106)		[45]
ChinaUrbanPM2.5Microscopy0.73-1.52 ×105 at 1.5 m
0.59-1.42 ×105 at 100 m
0.69 – 0.97 ×105 at 229.5 m		[46]
KoreaUrbanTSPqPCR5.19×101-4.31×103[47]
ItalyUrbanTSPqPCR1.70×105 (104-105)[13]
Caribbean SeaUpper troposphereAerosolqPCR
Microscopy		5.10×103
1.50×105		[21]
JapanSuburbanAerosolqPCR1.80×104 (1.10×103-1.30×105)[48]
ChinaUrban, suburban, costal urban, industrial urbanPM2.5qPCR1.19×105 (4.82×104-2.64×105)[49]
ChinaUrbanPM2.5qPCR1.90×105 before biomass burning
1.20×105 after biomass burning		[50]
ChinaUrbanPM2.5qPCR106 on middle pollution days
105 on Heavy pollution days		[51]


세균의 16S rRNA 유전자 부분을 정량적으로 PCR (qPCR) 하여 얻은 gene copy number를 세균 개체수로 환산할 수 있다[52, 53]. 이러한 qPCR 방법으로 세균 개체수를측정한 결과, 대기 시료 대부분의 세균 개체수는 103-105 cells/m3 수준이었다[13, 21, 47-51]. 대기 오염도가 심해지면 대기 중 세균 개체수는 감소하였다[51]. 한편, DeLeon-Rodriguez et al. (2013)은 대류권에서 채취한 에어로졸 시료를 대상으로 현미경과 qPCR 방법으로 세균 개체수를 측정비교한 결과, 현미경으로 측정한 개체수가 qPCR법으로 측정한 값의 약 30배 정도 많았다[21].

대기 시료 중에 함유된 곰팡이 개체수를 측정한 결과를Table 2에 정리하였다. 배양법을 이용하여 측정한 곰팡이 개체수는 102-103 cells/m3 수준이었으나[35, 37, 54], 비배양법인 qPCR을 이용하여 측정한 개체수는 103-104 cells/m3 이었다[47, 50]. Li et al. (2015)은 중국의 도심에서 연무가 없는 날에 비해 연무가 있는 날의 곰팡이 개체수가 많았다고보고하였는데, 이는 세균 개체수 결과와 일치하는 결과이다(Table 1) [35].

Table 2 . Comparison of airborne fungal concentration.

Sampling siteSample typeMethodFungal concentration (cells/m3)Ref.
CountryLocation
GreeceCoastal cityAerosolCulture-dependent4.34×102 (102-103)[54]
ChinaUrbanAerosolCulture-dependent2.50×102 – 3.98×102 on non-hazy days
1.47×103 – 1.70×103 on hazy days		[35]
ChinaUrbanPM2.5Culture-dependent9.48×102 (4.10×10 – 7.21×103)[37]
KoreaUrbanTSPqPCR9.56×101-4.22×104[47]
ChinaUrbanPM2.5qPCR1.40×103 before biomass burining
4.20×104 after biomass burining		[50]


배양법을 이용해서 측정한 값에 비해 비배양법(cytometry, 현미경 및 qPCR 이용 방법)을 이용하여 측정한 대기 시료중 미생물 개체수가 10-100배 이상 높았다(Tables 1, 2). 이는 자연에 서식하는 미생물 중 현재 배양 기술의 수준으로배양 가능한 미생물이 극히 일부이기 때문으로, 향후에도 비배양법을 이용하여 측정한 다양한 대기 시료 대상의 세균 및곰팡이 개체수 정보가 많이 축적될 필요가 있다. 이러한 정보가 축적되면 대기 중 세균 및 곰팡이의 정량적인 거동 변화에 미치는 환경 인자의 영향에 대한 심도 있는 고찰이 가능해 질 것으로 사료된다.

비배양법을 이용한 AM의 메타게놈 분석 방법

Go to

에어로졸 혹은 PM 시료 채취 방법

AM 분석을 위한 대기 시료는 에어로졸, PM, 바이오에어로졸 형태로 채취할 수 있으며, 다양한 시료채취기(sampler)를 이용할 수 있다[55]. 시료채취기는 필터에 PM1, PM2.5, PM10 또는 TSP를 포집하는 체적 공기시료 채취기(volume air sampler)와, phosphate buffered saline (PBS) buffer나멸균된 증류수 등의 액체 또는 고체 배지에 바이오에어로졸을 포집하는 채취기가 있다[56]. 바이오에어로졸 채취기는 주로 사이클론(cyclone), 임팩터(impactor), 임핀저(impinger),포자 트랩(spore trap)이 이용된다[57, 58]. AM의 메타게놈연구에 사용되었던 대표적인 채취기와 채취 정보를 Table 3에 정리하였다.

Table 3 . Sampling information in different samples and samplers.

SampleSamplerCollection surfaceFlow rateTimeRef.
PM or aerosolHigh-volume air samplerQuartz fiber filters113023-24 h[59, 60]
105023 h 30 min[61]
50023 h 50 min[62]
25024 h[13]
Polyester membrane filters100024 h[63]
Glass fiber filters117024 h[64]
12 h[44]
22524 h[47]
(Self-built)3007 days[65]
Medium-volume air samplerQuartz fiber filters76.723 h 40 min[66]
Glass fiber filters10020-24 h[51, 67, 68]
Teflon filters23h[50]
Polycarbonate membranes16.724 h[69]
16.71 h[46]
Mini-volume samplerQuartz fiber filters540 min[66]
Vacumm pump filtrationQuartz fiber filters16.7-[70]
Cellulose nitrate filters301.5 h[39]
203 h[21]
168 h 30 min[40]
Polycarbonate filters103 h[48]
0.31-24 h[33]
-12 h[71]
BioaerosolCycloneTeflon filters16.724 h[72]
Eppendorf tubes (1.5 mL)--[73]
Liquid buffer4502 h[74]
ImpactorMedium28.33 min[36]
Cellulose filters + medium28.315 min[75]
Petroleum jelly1801 h[76]
-53030 min[15]
Spore trapTubes, tapes10-[77]
Tapes--[78]
ImpingerLiquid buffer (sterile water, PBS buffer. Tween solution etc.)8003 h[17]
21 h[79]
12.53 h[43]
12.51 h[40]
1020 min[38]


체적 공기시료 채취기는 유량에 따라 고용량(high-volume, 225 L/min 이상), 중용량(medium-volume, 76.7-100 L/min),저용량(low-volume, 16.7 L/min) 및 소용량(mini-volume, 5L/min)으로 나뉜다[13, 21, 33, 39, 40, 44, 46-48, 50, 51, 59-71]. 주로 사용되는 채취용 필터는 유리나 석영 등의 섬유 필터 및 폴리카보네이트(Polycarbonate)나 셀룰로스(cellulose) 등의 멤브레인이 있다[80, 81]. Fig. 2에 고용량 공기시료 채취기를 나타내었는데, TSP는 특별한 거름 장치 없이 필터에 바로 포집되고(Fig. 2A), PM은 포집하고자 하는입자 크기에 따라 분류 구역(fractionation zone)에서 분리되어 필터에 포집된다(Fig. 2B). 공기시료 채취기를 직접 제작및 개조하거나[65], 진공 펌프를 이용한 보틀 탑 여과장치(bottle top filtration)로 필터에 에어로졸을 포집한 연구도있었다[19, 21, 33, 39, 48]. 필터를 이용한 샘플링은 채취하기에 쉽고 용이하여 가장 일반적으로 활용되는 AM 시료 채취 방법이다[82]. 바이오에어로졸 채취기 중 사이클론과 임팩터도 포집면으로 필터를 이용할 수 있다[57].

Figure 2.Schematic diagram of high volume air sampler with (A) TSP and (B) PM 2.5 or PM10.

사이클론, 임팩터, 임핀저의 기본 원리는 공기 흐름의 급격한 방향 변화를 이용한 것으로, 일정 크기와 무게 이상의 입자는 관성력으로 인해 공기 흐름의 방향을 따라가지 못하고 포집면으로 떨어져 채취된다[55, 81]. Fig. 3에 사이클론을 모식화하였다. 사이클론에 유입된 공기는 나선형으로 소용돌이 치며 흐르고, 그 원심력으로 인해 더 크고 무거운 입자가 벽에 부딪치며 분리되어 사이클론 아래쪽에 쌓인다. 이렇게 사이클론 아래쪽에 1.5 mL 튜브를 설치하여 공기 시료를 포집한다. 또는 나선형의 공기 흐름이 사이클론 바닥에도달하면 소용돌이 가운데에 위로 흐르는 공기 흐름이 생기는데, 아래로 떨어지지 않은 작은 입자들이 위쪽으로 향하는공기흐름을 따라 올라가게 되고, 사이클론 위쪽에 설치한 포집면에 채취하기도 한다[57, 81]. 따라서 사이클론은 포집면으로 필터, 튜브, 액체 등을 다양하게 활용해왔다[72-74].

Figure 3.Schematic diagram of cyclone.

Fig. 4에는 임팩터를 그림으로 나타내었다. 임팩터는 바이오에어로졸 채취에 가장 일반적으로 쓰이며, 한 펌프에 여러개를 설치하거나 입자 크기에 따라 다층으로 분류하여 채취하는 것이 가능하다[82]. 진공 펌프를 통해 노즐을 통과한 공기가 임팩터에 유입되면 슬릿을 지나 수직으로 위치한 포집면에 부딪쳐 공기가 꺾이게 되고 가볍고 작은 입자들은 공기의 흐름을 따라 이동하지만, 크고 무거운 입자는 공기 흐름이 꺾일 때 원심력에 의해 공기 흐름에서 탈락되어 포집면에 채취된다[15, 81]. 임팩터의 포집면은 필터, 페트리 디쉬의 아가 배지, 윤활유 등을 바른 플레이트나 테이프 등 다양하다[36, 75, 76, 81].

Figure 4.Schematic diagram of impactor.

포자 트랩은 공기의 움직임이 아닌 중력을 이용하여 포집하는 Durham-type과, 임팩터와 같은 원리를 사용하는Burkard/Hirst-type 및 슬릿 카트리지(slit cassettes)가 있다[81-83]. Fig. 5에 임팩터의 원리를 이용한 포자 트랩을 모식도로 나타내었다. Fig. 5A의 카트리지 타입은 소형화된 임팩터와 같은 모습으로 슬라이드 글라스 위에 얇게 배지가 올려져 있는 포집면에 AM이 채취된다[82]. Fig. 5B와 같은Burkard/Hirst-type은 원통형 드럼 안에 설치한 테이프가 천천히 돌아가며 포자가 채취된다[81]. Serrano-Silva and Calderón-Ezquerro (2018)는 포자 트랩 종류에 따른 군집 분석 결과를 비교하였는데, 626개의 박테리아 속 중 Hirst-type에서 623개, Durham-type에서 490개가 발견되어 Hirst-type의 채취 결과가 더 우수한 것으로 나타났다[77].

Figure 5.Schematic diagram of (A) cassette type and (B) Burkard/Hirst-type of spore trap.

마지막으로 액체 포집면을 이용한 임핀저를 Fig. 6에 그림으로 나타내었다. 임핀저는 임팩터와 같은 원리로 작동하며, 1947년 Rosebury에 의해 처음으로 고안되었다[82]. 액체 포집면에 채취되기 때문에 미생물들의 활성이 유지되기 용이하며, 공기 채취기보다 비교적 포집 시간이 짧았다[17, 38, 40, 79].

Figure 6.Schematic diagram of liquid impinger.

위와 같이 채취기 종류가 다양하므로 분석 목적에 따라 다른 방법으로 시료를 채취할 수 있는데, 어떤 종류와 크기의미생물을 어떤 방법으로 연구할 것인지에 따라 채취기를 선택하고 조건을 결정해야 한다[57]. 예를 들어 전통적인 배양기반 분석에서는 액체 또는 고체 배지로 된 포집면을 사용하는 것이 더 적합하지만[82], 유량이 너무 크거나 포집 시간이 길 경우 포집면이 건조되어 배양 가능한 미생물을 포집하기에 부적당할 수 있으므로 다양한 조건을 고려해야 한다[84].

포집 효율은 시료채취기에 따라 다른데, 관성력을 이용하는 바이오에어로졸 채취기의 포집 효율은 공기의 유량, 포집면의 크기와 양, 장치 내 공기 분출구와 포집면의 거리에 따라 결정되며, 분리입경(cut-off diameter)과 함께 분석된다[84]. 분리입경은 포집 가능한 최저 입경을 의미하며 분리 입경 이하의 작은 입자들은 포집되지 않고 채취기를 지나치므로, 이상적으로는 분리입경 이상의 입자는 100% 포집되어야하지만 실제로는 그렇지 않다. 따라서 관성력을 이용한 채취기의 입자 직경에 따른 포집 효율 곡선에서 50%의 효율을나타내는 입자의 직경을 분리입경(d50)으로 정의한다. 채취기의 유량이 클수록 분리입경은 작아지고 채취할 수 있는 입자가 많다[81]. 일반적으로 세균은 1 µm 정도이지만 세균 덩어리(bacterial aggregates)를 이루거나 큰 입자에 붙어있기때문에 포집하기에 용이하고, 곰팡이 입자는 보통 2-5 µm이므로 포집 효율이 더 높은 편이다[84]. 최근에는 대기물리화학적 요인 및 PM 입경에 따른 AM 군집 차이 분석이 많이 진행됨에 따라 고용량 공기시료채취기(high-volume air sampler)를 이용하여 섬유 필터에 PM2.5를 채취하여 사용하는 경우가 많았다[61, 62].

DNA 추출 방법

미생물 군집 분석에서 중요한 첫번째 단계는 DNA 추출로, 서로 다른 환경에서 다르게 나타나는 군집을 비교하기위해서는 높은 수준의 DNA 추출이 관건이다[85]. 상용화된DNA 추출 kit 또는 선행연구에서 제시한 추출 방법 한 가지만으로 수행된 DNA 추출 결과는 DNA 농도와 순도에 영향을 미쳐 메타게놈 분석 결과가 과대 또는 과소 평가될 수있다[58]. 특히 공기 시료와 같이 채취 시료에 따라 다량의미생물이 서식 중이라는 보장이 어려운 경우에는 NGS (Next-Generation Sequencing) 분석에 적합할 정도의 질과고농도로 추출된 DNA를 얻는 것이 쉽지 않다[58]. 공기시료는 포집면에 따라 테이프, 아가 배지, 액체 및 필터에 부착된 형태로 채취되며, 그 중 필터는 포집 효율이 높으며 보관이나 채취 과정에서 다루기에 용이하다[81]. 또한 미생물의 생장성을 유지하기에 부적합하지만, 전통적인 배양법과달리 생장성이 없는 미생물이나 균사 조각만으로도 DNA 분석이 가능한 점 때문에 메타게놈 연구방법에서 자주 이용되는 채취 시료 형태이다[86].

그러나 필터가 DNA 추출시 저해요소로 작용하여 DNA 추출 방법에 추가적인 처리과정이 요구된다[86]. Table 4에 그동안 사용된 DNA 추출 방법 및 추가 처리 과정을 정리하였다. 상용화된 DNA 추출 kit를 사용하는 경우가 대부분이었으며, 토양 시료용 kit를 이용하는 경우가 많았고 식물 시료용 kit를 사용하는 경우도 있었다. 특히 MoBio사(현재 Qigen사로 병합됨)의 Soil kit가 가장 많이 사용되었고, MP사나Qiagen사의 kit가 그 다음으로 많이 이용되었다. 시료 전처리의 경우, 필터의 먼지를 긁어내거나 필터의 먼지 부분만얇게 떠서 사용한 (scratching or slicing) 경우에는 다른 과정을 추가하지 않았다[43, 70, 72]. 필터에서 시료만 분리하여 DNA 추출하기 위해 Tween 20 등의 세제를 추가한 PBS나 멸균수에 필터를 담그고 원심분리 등을 통해 씻어내는(washing) 전처리도 하였다[60, 63, 71, 88]. 그 중 필터를 씻어낸 용액을 다른 필터에 거른 후 새로운 필터로 DNA 추출을 수행하기도 하였다[60]. 반면 필터를 막자 사발에 갈아서PM과 필터를 가루 형태로 만든 뒤 DNA 추출한 경우도 있었다[59, 61, 62, 66, 87]. 온도를 높여주는 과정(heating)은세포 용해를 위한 용액을 넣은 후 65℃ 전후에서 수행되었다[39, 44]. 필터에서 바이오매스를 떨어트리거나 세포 파괴를 돕기 위해 물리적인 방법들이 활용되었는데, 교반, 원심분리 및 볼텍싱이 많이 사용되었고 초음파처리를 추가하거나 kit 매뉴얼에 있는 비드비팅(bead-beating) 시간을 늘려서 수행한 경우도 있었다[13, 39, 44, 60, 63, 65, 68, 71, 87, 88]. 화학적인 방법으로는 세포 용해 용액에 담그는 과정을더 길게 수행하는 방법을 택하기도 하였다[13, 65]. Chen et al. (2021)의 경우에는 DNA 추출 과정 중 마지막 DNA binding 과정에서 세포가 용해된 시료 여러 개를 농축하여DNA 농도를 높였다[66].

Table 4 . Additional processes according to methods of DNA extraction.

Additional processesDNA extractionRef.
Cutting into small piecesScratching or slicingWashingFilteringGroundingHeatingShakingCentrifugingVoltexingSonicationBead-beatingLonger lysis
●Power Soil DNA isolation kit[66]
●[69]
●[70]
●●[59, 62]
●●●●●[60]
●●●[44]
●[43]
●●●[39]
●[72]
●●●●●UltraClean Soil DNA Isolation Kit[63]
●●FastDNA SPIN Kit for Soil[68]
●●●FastDNA SPIN Kit for Soil[13]
●Fast-DNA SPIN Kit[67]
●[49]
●●DNeasy PowerSoil Kit[61]
●●DNeasy plant mini & maxi kit NucleoSpin plant II & maxi kit[87]
●●●LysingMatrixE, Fast DNA Spin Kit for Soil[65]
●●●●E.Z.N.A. Soil DNA Kit[88]
●●Phenol-chloroform extraction[71]


이렇게 필터의 저해 작용 및 세포 파괴를 효율적으로 수행하기 위해 다양한 전처리 및 추가 처리과정이 요구됨에 따라 DNA 수율을 높이기 위한 추출 방법 비교한 연구가 보고되었다[89, 90]. 공기 시료를 채취한 필터의 DNA 추출 효율을 확인하기 위하여, 깨끗한 두 가지(석영, 유리) 섬유 필터와 PM10을 72시간 포집한 두 필터 모두에 gram-positive (B. atrophaeus), gram-negative (E. coli) 및 spores (A. fumigatus)를 접종하여 DNA 추출한 연구도 있었다[91]. Mobio사의 kit를 이용하였으며, bead-beating과 voltexing과정을 추가로 수행하였다. 모든 필터에서 박테리아보다 A. fumigatus의 추출 효율이 더 높았으며, PM을 포집한 필터와 깨끗한 필터의 효율 차이는 크지 않았고, 유리 섬유 필터보다 석영 섬유 필터의 DNA 추출 효율이 상회하였다[91]. DNA 추출 방법의 차이를 비교한 연구로는, 2016년 여름 텍사스에서 트랩을 이용하여 포집한 액체 시료를 멤브레인 필터에 여과한 후 수행한 결과가 있었다[89]. DNA 추출은 (1) cetrimonium bromide (CTAB-chloroform), (2) DNeasy Plant Maxi Kit (Qiagen, Germany), (3) PowerPlant Pro DNA Isolation Kit (Qiagen)의 세 가지 방법을 이용하였는데, PowerPlant Pro DNA Isolation Kit를 이용하여 qPCR수행 결과 CT 값이 가장 작아 우수한 결과를 보였으나, 가격적인 측면에서는 CT 값 차이가 크지 않으면서 더 저렴한CTAB를 추천하였다. 다만, PowerPlant Pro DNA Isolation Kit의 경우 저해 요소의 영향이 큰 편으로 추가적인 과정이더 필요할 수 있고, CTAB를 이용할 경우 시약을 다룰 때 안전 문제를 주의해야 한다고 보고하였다. Luhung et al.(2015)은 싱가포르에서 2013년 여름, 난양기술대학 내 공기조화기의 필터 시료와 그 주변 야외에서 polyethersulphone멤브레인 필터에 진공펌프로 포집한 시료를 DNA 추출 시, 수율을 높일 수 있는 전처리 방법을 비교 연구하였다[90]. DNA 추출에는 Power Water kit (MOBIO Carlsbad, USA)를 이용하였으며, 초음파 처리하는 수조의 온도를 55-75℃범위에서 실험한 결과 65℃가 최적의 온도였고, 65℃에서 초음파처리를 한 경우가 하지 않은 경우보다 2배 이상 수율이높았다. 또한 DNA 추출과정에서 세포 용해 및 저해 요소 제거 후 DNA binding 과정에서 필터 3개를 모아 농축하여 추출한 경우와 필터 1개만 추출한 경우를 비교하였는데, 농축한 경우가 주변 공기 필터는 2.5-3.9배, 공기조화기 필터는3.2-3.4배 DNA 농도가 더 높아 3배 높게 나올 것이라는 이론상 수치와 비슷하게 나타났다.

포집면이 필터가 아닌 경우에는 전처리 과정을 추가하는경우가 더 적었고, DNA 추출 kit보다 phenol-chloroform 이나 CATB 방법을 이용하는 경우가 많았다[21, 33, 36, 64, 79]. 액체 포집면에 채취한 경우에는 고르게 잘 섞어주는 과정이 전처리로 수행되었다[36]. 독특한 추가 처리과정으로는, 세포 용해과정에서 37℃에서 30분, 70℃에서 30분 정치후 -172℃의 액체 질소와 100℃의 끓는 물을 번갈아 3번 이동하는 과정을 수행하였다[79].

Primer 및 PCR 조건

Polymerase chain reaction (PCR)은 특정한 핵산을 증폭하는 기술로, 미생물 시퀀싱에 활용되며 다양하게 적용되어왔으나, 상황에 따라 다른 프로토콜이 필요하므로 PCR 조건의 최적화 과정이 필요하다[92]. PCR 수행에서는, 시퀀싱을 원하는 ribosomal DNA 영역에 따라 다른 프라이머(primer)를 선택해야 하며, 시퀀싱 기술에 따라 분석 가능한유전자 영역과 최적의 염기서열 길이를 고려하여 프라이머조합을 구성해야 한다[93]. 프라이머 길이는 PCR 반응의 특이성과 annealing 온도와 관련있으므로 프라이머에 따라 다른 온도 조건이 요구된다[94]. 따라서 본 논문에서는 AM 메타게놈을 분석한 기존 연구들이 사용한 유전자 영역에 따른프라이머 및 PCR 조건을 정리하였다. 박테리아 분류를 위해 16S rRNA 유전자 영역이 사용되며, 16S rRNA는 V1- V9의 9가지 V 영역으로 구성되어 있다[95]. Table 5는 기존연구에서 사용한 16S rRNA 영역의 프라이머에 따른 PCR온도 조건을 나타낸 표이다. 전통적인 Sanger sequencing과pyrosequencing을 위한 프라이머는 V1-V9 영역을 모두 포함하는 27F와 1492R이 사용되었고, pyrosequencing에서annealing 시간이 2분으로 긴 편이었다[15, 17, 36, 71]. Pyrosequencing에 사용된 다른 프라이머 쌍은 52-55℃에서30-60초 동안 annealing 과정을 거쳤는데, GM3F와 907R프라이머 쌍만 44℃에서 90초로, 낮은 annealing 조건으로수행되었다[43, 65, 74, 79, 88, 97]. DGGE에 사용된 GM3F와 GM4R 프라이머의 annealing 조건 또한 45℃에서 1분으로 낮은 온도 조건이었다[48]. 차세대 염기서열 분석 방법인Illumina Miseq에 사용된 프라이머 쌍은 8F와 518R, 341F와 805R, 338F와 806R, 515F와 806R, Bakt_341F와Bakt_805R가 있었고, annealing 조건은 50-56℃에서 30-50초범위에 있었다. 그 중 338F와 806R, 515F와 806R 프라이머가 많이 사용되었고, 같은 프라이머를 사용해도 온도 조건이다른 경우도 있었다. PCR 결과는 온도 및 시간 조건뿐만 아니라 시료의 DNA 추출량과 순도, PCR에 사용되는 buffer조성 등도 영향을 미치기 때문으로 판단된다[90]. 표에는 포함하지 않았지만, Ion 16S™ Metagenomics Kit, catalogue number A26216 (Thermo Fisher Scientific Inc.)를 이용하여 V2-V9까지의 여러 영역에 대하여 PCR 수행한 연구도 있었다[77].

Table 5 . Primer and PCR conditions for bacteria (16S rRNA gene) sequencing.

Method of sequencingPrimersPCR conditionRef.
ForwardReverseInitial denaturationCyclesDenaturationAnnealingExtensionFinal extension
Sanger sequencing27F (AGAGTTTGATCMTGGCTCAG)1492R (GGYTACCTTGTTACGACTT)95°C, 2 min3095°C, 30 s50°C, 30 s72°C, 45 s72°C, 7 min[15]
94°C, 5 min3094°C, 30 s55°C, 30 s72°C, 30 s72°C, 10 min[36]
PyrosequencingNo info.3095°C, 60 s55°C, 2 min72°C, 2 minNo info.[17]
No info.3094°C, 60 s56°C, 2 min72°C, 2 minNo info.[71]
27F (CGTATCGCCTCCCTCGCGCCATCAG)533R (CTATGCGCCTTGCCAGCCCGCTCAG)95°C, 2 min2595°C, 30 s55°C, 30 s72°C, 30 s72°C, 5 min[88]
109f (ACKGCTCAGTAACACGT)934r (GTGCTCCCCCGCCAATTCCT)94°C, 3 min3594°C, 30 s52°C, 30 s72°C, 90 s72°C, 5 min[65]
S D-Bact-0341-b-s-17 (CCTACGGGNGGCWGCAG)S-D-Bact 0785-a-A-21 (GACTACHVGGGTATCTAATCC)94°C, 3 min3094°C, 30 s53°C, 40 s72°C, 60 s72°C, 5 min[43]
GM3F (AGAGTTTGATCMTGGC907R (CCGTCAATTCMTTTGAGTTT)94°C, 10 min3094°C, 60 s44°C, 90 s68°C, 2 min68°C, 5 min[79]
V3_357F (CCTACGGGAGGCAGCAG)V5_926R (CCGTCAATTCMTTTRAGT)No info.[74]
341F (CCTACGGGAGGCAGCAGGC)907R (CCGTCAATTCMTTTRAGTTT)5 min3095°C, 60 s55°C, 60 s72°C, 60 s72°C, 10 min[97]
DGGE341F (CCTACGGGAGGCAGCAGGC)518R (ATTACCGCGGCTGCTGG)94°C, 3 min3594°C, 60 s60°C, 60 s72°C, 60 s72°C, 3 min[48]
GM3F (AGAGTTTGATCMTGGC)GM4R (TACCTTGTTACGACTT)94°C, 3 min3594°C, 60 s45°C, 60 s72°C, 60 s72°C, 3 min
Ion S5™ XL Sequencing515F (GTGCCAGCMGCCGCGGTAA)806R (GGACTACHVGGGTWTCTAAT)98°C, 60 s3098°C, 10 s50°C, 30 s72°C, 30 s72°C, 5 min[64]
Illumina MiSeq8F (AGAGTTTGATCCTGGCTCAG)518R (ATTACCGCGGCTGCTGG)95°C, 10 min3595°C, 15 s52°C, 45 s72°C, 30 s72°C, 10 min[96]
338F (ACTCCTACGGGAGGCAGCA)806R (GGACTACHVGGGTWTCTAAT)94°C, 5 min2994°C, 30 s50°C, 30 s72°C, 45 s72°C, 5 min[66]
94°C, 2 min2594°C, 30 s56°C, 30 s72°C, 30 s72°C, 5 min[51]
94°C, 5 min3094°C, 30 s50°C, 30 s72°C, 45 s72°C, 5 min[59,62]
98°C, 2 min3098°C, 15 s55°C, 30 s72°C, 5 minNo info.[46]
515F (GTGCCAGCMGCCGCGGTAA)806R (GGACTACHVGGGTWTCTAAT)94°C, 3 min3594°C, 45 s50°C, 60 s72°C, 90 s72°C, 10 min[55,70,72]
Bakt_341F (CCTACGGGNGGCWGCAG)Bakt_805R (GACTACHVGGGTATCTAATCC)No info.[76]

No info., No information.

곰팡이 분류를 위해서는 18S rRNA 유전자, ITS (internal transcribed spacer) 및 28S rRNA 유전자 영역을 사용하는데[97], 해당 영역의 프라이머와 PCR 조건을 시퀀싱 방법에따라 Table 6에 정리하였다. Sanger sequencing에 ITS4와ITS5를 이용하여 PCR 수행한 annealing 온도는 67℃로 높았으며, Ion Torrent sequencing의 tmL-c와 tmL-h가 61℃, pyrosequencing의 ITS5와 ITS4Z가 45℃ 조건이었던 것을제외하면 50-58℃ 범위의 일반적인 온도 조건에서 수행되었다. Annealing 시간 조건이 가장 짧았던 프라이머 조합은c-A4125와 d-B49863, ITS3과 ITS4의 15초 조건이었으며 이외 조건들은 30-60초 범위에 속하였다. 박테리아의 16SrRNA 영역 PCR에서는 27F와 1492R, 338F와 806R, 515F와 806R이 일반적으로 이용되었던 것에 비해 곰팡이 분류를 위한 PCR 프라이머는 더 다양한 종류와 조합으로 수행되었다. 또한 Fröhlich-Nowoisky et al. (2009)는 4개의forward 프라이머와 8개의 reward 프라이머의 8가지 조합으로 PCR 수행 후 염기서열을 분석하여 곰팡이 군집 다양성을 조사하였다[65].

Table 6 . Primer and PCR conditions for Fungi (ITS and 18S gene) sequencing.

Method of equencingPrimer (5′-3')PCR conditionRef.
ForwardReverseInitial denaturationCyclesDenaturationAnnealingExtensionFinal extension
Sanger sequencingITS4 (TCCTCCGCTTATTGATATGC)ITS5 (AGTAAAAGTCGTAACAAGG)95°C, 10 min3094°C, 30 s67°C, 60 s72°C, 60 s72°C, 10 min[73]
c-A49325 (CGAAATCGGTAGACGCTACG)d-B49863 (GGGGATAGAGGGACTTGAAC)94°C, 2 min3094°C, 30 s55°C, 15 s65°C, 2 min65°C, 10 min[98]
PyrosequencingITS5 (GGAAGTAAAAGTCGTAACAAGG)ITS4 (TCCTCCGCTTATTGATATGC)94°C, 3 min3594°C, 30 s54°C, 30 s72°C, 90 s72°C, 5 min[65]
ITS5 (GGAAGTAAAAGTCGTAACAAGG)ITS4B (CAGGAGACTTGTACACGGTCCAG)94°C, 3 min3594°C, 30 s58°C, 30 s72°C, 90 s72°C, 5 min
ITS5 (GGAAGTAAAAGTCGTAACAAGG)ITS4A (CGCCGTTACTGGGGCAATCCCTG)94°C, 3 min3594°C, 30 s58°C, 30 s72°C, 90 s72°C, 5 min
ITS5 (GGAAGTAAAAGTCGTAACAAGG)ITS4Z (TCCTCCGCTTATTRATATGC)94°C, 3 min3594°C, 30 s45°C, 30 s72°C, 90 s72°C, 5 min
ITS5 (GGAAGTAAAAGTCGTAACAAGG)ITS4C (TCCTCCGCTTATTGATATGC)94°C, 3 min3594°C, 30 s53°C, 30 s72°C, 90 s72°C, 5 min
ITS1 (TCCGTAGGTGAACCTGCGG)5.8S (TCGATGAAGAACGCAGCG)94°C, 3 min3594°C, 30 s55°C, 30 s72°C, 90 s72°C, 5 min
18Sai (CCTGAGAAACGGCTACCACATC)18Sbi (GAGTCTCGTTCGTTATCGGA)94°C, 3 min3594°C, 30 s55°C, 30 s72°C, 90 s72°C, 5 min
18S-H17F (AAATTACCCACTCCCGGCA)18S-H35R (TGGTGAGGTTTCCCGTGTT)94°C, 3 min3594°C, 30 s58°C, 30 s72°C, 90 s72°C, 5 min
NS1 (GTAGTCATATGCTTGTCTC)NS2 (GGCTGCTGGCACCAGACTTGC)95°C, 5 min3095°C, 60 s55°C, 60 s72°C, 60 s72°C, 10 min[97]
ITS1F (CTTGGTCATTTAGAGGAAGTAA)ITS4 (TCCTCCGCTTATTGATATGC)95°C, 3 min3095°C, 60 s51°C, 60 s72°C, 60 s72°C, 10 min
T-RFLPITS1F (CTTGGTCATTTAGAGGAAGTAA)ITS4 (TCCTCCGCTTATTGATATGC)94°C, 5 min3594°C, 60 s50°C, 60 s72°C, 90 s72°C, 10 min[47]
Ion Torrent sequencingtrnL-c (CGGTAGACGCTACG)trnL-h (CCATTGAGTCTCTGCACCTATC)98°C, 30 s2598°C, 30 s61°C, 30 s72°C, 30 s72°C, 5 min[78]
Illumina MiSeqITS1F (CTTGGTCATTTAGAGGAAGTAA)ITS4 (TCCTCCGCTTATTGATATGC)95°C, 5 min3095°C, 60 s54°C, 45 s72°C, 60 s72°C, 10 min[96]
ITS3 (GCATCGATGAAGAACGCAGC)ITS4 (TCCTCCGCTTATTGATATGC)95°C, 10 min3595°C, 15 s52°C, 45 s72°C, 30 s72°C, 10 min
ITS1F (CTTGGTCATTTAGAGGAAGTAA)ITS2 (GCTGCGTTCTTCATCGATGC)94°C, 3 min3594°C, 45 s50°C, 60 s72°C, 90 s72°C, 10 min[87]
ITS86 (GTGAATCATCGAATCTTTGAA)ITS4 (TCCTCCGCTTATTGATATGC)95°C, 2 min4095°C, 30 s55°C, 30 s72°C, 60 s72°C, 10 min[76,87]
ITS5 (GGAAGTAAAAGTCGTAACAAGG)ITS2 (GCTGCGTTCTTCATCGATGC)No info.[67]
ITS1F (CTTGGTCATTTAGAGGAAGTAA)ITS2 (GCTGCGTTCTTCATCGATGC)94°C, 2 min3594°C, 30 s50°C, 30 s72°C, 30 s72°C, 5 min[50]
1737F (GGAAGTAAAAGTCGTAACAAGG)2043R (GCTGCGTTCTGCATCGATGC)94°C, 5 min3094°C, 30 s56°C, 30 s72°C, 45 s72°C, 5 min[62,69]
ITS3_KYO2 (GATGAAGAACGYAGYRAA)ITS4 (TCCTCCGCTTATTGATATGC)No info.[61]
1737F (GGAAGTAAAAGTCGTAACAAGG)2043R (GCTGCGTTCTGCATCGATGC)94°C, 5 min2994°C, 30 s56°C, 30 s72°C, 45 s72°C, 5 min[66]
ITS-p3 (YGACTCTCGGCAACGGATA)ITS4 (TCCTCCGCTTATTGATATGC)No info.[76]

No info., No information

대기 환경 중 세균과 곰팡이 메타게놈의 다양성

Go to

특정 지역에서 계절 혹은 대기오염도별로 채취한 에어로졸 혹은 PM 시료를 대상으로 세균과 곰팡이 메타게놈의 종풍부도(richness) 및 다양성(diversity)을 분석한 결과를Table 7에 정리하였다. 시료에서 발견되지 않거나 보이지 않은 종이 남아 있을 가능성을 고려하여, 발견된 종의 정보를 바탕으로 종에 대한 풍부도를 추정하는 지표인 Chao 1 값은시료를 채취한 지역, 계절 및 대기오염도에 따라 매우 상이하였다(Table 7).

Table 7 . Comparison of microbial diversity in aerosol and PM samples.

Sample (Sampling site)Pollution (μg-PM10/m3)Bacteria/FungiSeasonMicrobial diversityRef.
No. of OTUChao 1ACEShannon indexSimpson index
Aerosol (Mainz, Germany)No informationFungiAll season5.20.01[65]
TSP (Seoul, Korea)No informationBacteriaWinter3.62[47]
Fungi3.04
TSP (Milan, Italy)25.58 (PM10)BacteriaSpring522.31[13]
22.18 (PM10)Summer502.4
38.48 (PM10)Fall512.39
45.03 (PM10)Winter522.3
PM2.5 (Beijing-Tianjin-Hebei, China)35-194BacteriaSpring6477006894.140.12[49]
PM2.5 (Beijing, China)AQIa, 0 – 300BacteriaSpring24207608146493.170.94[62]
Summer837190029162.540.99
Fall2078343843685.020.97
Winter2730503176904.660.95
FungiSpring67082412982.350.98
Summer2973343513.011
Fall3544636292.260.99
Winter6276467213.370.99
PM2.5 (Beijing, China)AQI, 0-100BacteriaSpring2181417775434.56[59]
Summer1607343055335.42
Fall3052417068955.69
Winter48846082110796.13
FungiSpring2213945291.82
Summer1653596790.85
Fall5096147932.68
Winter9847439432.91
AQI, 101-200BacteriaSpring1880436081704.25
Summer1408219731765.22
Fall3084358959095.51
Winter43286297111626.13
FungiSpring2835437262.11
Summer1543927401.3
Fall3644355661.95
Winter96482012042.91
AQI, 201-300BacteriaSummer1005160618735.04
Fall2158254536485.43
Winter3527441672365.94
FungiSummer1792973920.95
Fall3403655581.77
Winter85193112473.36
AQI, >300BacteriaWinter3723442163156.02
FungiWinter8787278843.32
Aerosol (Mexico city, Mexido)[Sampling method]BacteriaFall47138.940.99[77]
Durham-type spore trap
Hirst-type spore trap582410.581
High-throughput Jet sampler32608.180.99
PM2.5 (Beijing, China)AQI, 0-300, > 300BacteriaAll season5.6[67]
FungiAll season3.89
PM2.5 (Jinan, China)AQI, < 100BacteriaFall/Winter0.84[38]
AQI, 101-1500.96
AQI, 150-2000.95
AQI, 201-3000.91
PM2.5 (Xinxiang, China)BacteriaSpring2343225723109.630.99[64]
Summer1608162516199.171
Fall1312132013307.070.94
Winter1993209020817.910.97
PM2.5 (Yucheng, China)96.3BacteriaSummer[50]
Before biomass burning3553883803.610.09
After biomass burning3644174133.610.08
FungiSummer
Before biomass burning29731831820.34
After biomass burning2462762971.660.44
PM2.5 (Guilin, China)15-176BacteriaWinter[68]
Haze day27604105034.410.86
Non-Haze day29544585384.730.88
PM2.5 (Nanchang, China)Urban, 37.5FungiSpring4888168324.950.89[61]
Suburban, 27.75278568705.210.9
Forest, 22.95408518745.670.93
PM2.5 (Jinan & Weihai, China)Jina, 69.9BacteriaWinter89932.30.19[51]
Weihai, 36.640451.80.23
PM2.5 (Xi’an, China)FungiMountain[69]
Spring14302572506.360.96
Summer13853143156.170.95
Fall12172712726.510.97
Winter8142062055.210.95
Urban
Spring12471821825.250.93
Summer9162212215.790.96
Fall10642682696.480.97
Winter8662102135.870.96
PM2.5 (Xi’an, China)Non-pollution (22-70)BacteriaFall/Winter[46]
1.5 m7586.120.94
100 m9346.460.95
229.5 m5986.910.98
Pollution (105-195)Fall/Winter
1.5 m8095.850.93
100 m5855.580.92
229.5 m7225.510.91
PM2.5/PM10 (Beijing in China)44 (PM2.5)BacteriaSpring276337983.04[66]
63 (PM10)Summer132613135.1
Fall310833255.97
Winter425243186.41
All season
AQI, 0-50315035595.1
AQI, 51-100297332625.3
AQI, 101-150219827573.82
AQI, 151-200304333095.83
FungiSpring155916493.09
Summer7948053.29
Fall135713683.15
Winter186419663.58
All season
AQI, 0-50155316003.33
AQI, 51-100118812892.99
AQI, 101-150145414663.44
AQI, 151-200176617753.79


기온과 강수량 등은 PM의 미생물 다양성에 영향을 미칠수 있다. PM의 미생물 메타게놈 다양성에 미치는 계절 영향에 대한 연구 결과는 시료 채취 지역과 대기오염 정도에 따라 차이가 있지만, 전체적인 경향을 도출하기 위해 기존 연구결과를 종합적으로 분석하였다. PM의 세균 메타게놈의 다양성에 미치는 계절의 영향을 살펴보면, 종 풍부도 지표인Chao 1와 ACE 지표는 겨울철이 가장 높고, 그 다음 봄, 가을 및 여름 순이었다. 그런데, 종 다양성 지표인 Shannon 지표는 겨울 > 가을 > 여름 > 봄 순으로 겨울이 가장 높고 봄이 가장 낮았다. PM의 곰팡이 메타게놈의 다양성에 미치는계절적 영향은 세균 다양성에 미치는 영향과 매우 유사하였다. 종풍부도 지표인 Chao 1와 ACE 지표는 겨울철이 가장높고, 여름에 가장 낮았다. Shannon 지표는 겨울철에 가장높았고, 봄철에 가장 낮은 경향이 있었다. 여름철에는 강우가 빈번하게 내리고, 고온과 강한 자외선(UV) 복사로 인해 AM에 대한 살균 효과가 종 다양성에 영향을 미쳤을 것으로추측된다[66].

PM 메타게놈의 다양성은 대기오염도에 따라 달라지며, 기온과 강수량 등은 PM의 미생물 다양성에 영향을 미칠 수 있다. Du et al. (2018)은 중국 북경에서 대기오염도에 따라 세균과 곰팡이의 다양성을 분석한 결과, 대기오염도가 증가함에 따라 세균과 곰팡이의 다양성 지표값은 감소하였으나, 대기오염도가 매우 심하면(AQI 300 이상) 세균과 곰팡이의 다양성 지표가 다시 증가하는 경향이 있음을 보고하였다[62].또한, Chen et al. (2021)도 중국 북경에서 채취한 시료를 대상으로 PM의 세균과 곰팡이 다양성에 미치는 대기질 영향을 평가한 결과, 미생물 다양성은 대기질이 저하함에 따라감소했다가 다시 증가하였다[66].

대기 환경 중 세균 메타게놈 특성

Go to

우리나라, 일본, 중국, 미국 등에서 에어로졸 혹은 PM 시료를 채취하여 세균의 메타게놈을 문(phylum)과 속(genus) 수준에서 분석한 결과를 Table 8과 Table 9에 정리하였다.시료를 채취한 지역 및 계절과 대기오염 정도에 따라 세균메타게놈을 구성하는 세균 종류에는 매우 차이가 있지만, 문수준의 전체적인 특성을 파악하기 위해 Table 8의 결과를 이용하여 문 종류별 상대적 우점도의 분포와 중간값을 계산하였다(Fig. 7). 상대적 우점도의 중간값 기준으로, Proteobacteria의 비율이 가장 높았고(51.0%), 그 다음 Firmicutes (17.8%), Actinobacteria (13.0%), Bacteroidetes (7.7%), Cyanobacteria (3.2%) 그리고 Acidobacteria (1.8%) 순이었다.

Table 8 . Dominant bacterial phylum in aerosol and PM samples.

Sample (Sampling site)MethodPollutionSeasonBacterial phylumRef.
Acidobacteria (%)Actinobacteria (%)Bacteroidetes (%)Cyanobacteria (%)Firmicutes (%)Proteobacteria (%)
TSP (Seoul, Korea)T-RFLPNo informationWinter● (12.7)● (7.6)● (15.6)● (50.0)[47]
Aerosol (Colorado, USA)Pyrosequencing2.91×104 – 1.64×106 particles/m3Spring● (2.3)● (8.9)● (9.7)● (6.1)● (64.4)[40]
Summer● (1.5)● (13.0)● (6.6)● (4.9)● (60.3)
Fall● (1.8)● (16.0)● (7.7)● (19.6)● (44.1)
Winter● (1.9)● (11.8)● (12.7)● (8.4)● (59.7)
Aerosol (Caribbean Sea)PyrosequencingNo informationSummer● (6.4)● (5.3)● (0.5)● (5.4)● (81.0)[21]
Aerosol (Toposphere, Japan)Pyrosequencing1.05 – 8.84 ×106 particles/m3All season●●●●[19]
Aerosol (North Sea-Baltic Sea)PyrosequencingNo informationSummer● (16.3)● (22.9)● (8.3)● (49.3)[79]
Aerosol (Toyama, Japan)DGGENo informationAll season●●●●[48]
PM2.5 (Beijing-Tianjin-Hebei, China)Illunina Miseq35-194 μg/m3Spring●●●●[49]
Aerosol (Thessaloniki, Greece)PyrosequencingNo informationSpring/Summer/Winter● (17.0)● (10.0)● (3.0)● (18.0)● (47.0)[43]
PM2.5 (Gwangju, Korea)Illunina Miseq35.7 μg/m3Spring● (34.0)● (51.0)[99]
48.9 μg/m3● (4.5)● (29.0)● (57.0)
PM2.5 (Beijing, China)Illunina Miseq0 – 300 air quality index (AQI)aAll season● (33.9, dominant in summer and winter)● (3.19)● (15.3)● (19.9, dominant in fall)● (25.7)[62]
PM2.5 (Beijing, China)Illunina Miseq0 – 300 air quality index (AQI)aSpring●●●[59]
Summer/Fall/Winter●●●
PM2.5/PM10/TSP (Hangzhou, China)Ion Torrent Sequencing22-236 μg-PM2.5/m3
37-249 μg-PM10/m3		Winter● (16.5)● (11.6)● (18.0)● (15.5)● (32.2)[44]
Aerosol (Mexico city, Mexido)Ion Torrent Sequencing[sampling method]
Durham-type spore trap		Fall● (20.9)● (45.0)● (25.6)[77]
Hirst-type spore trap● (52.4)● (13.8)● (40.0)
High-throughput Jet sampler● (19.7)● (70.5)
Aerosol (Northern China)Illunina MiseqDust-bioaerosol 2016 CampainSpring●●●[33]
PM2.5 (Beijing, China)Illunina MiseqNon-Pollution ~ Severe pollution (AQI > 300)All season●●●●[67]
PM2.5 (Jinan, China)Illunina MiseqNon pollution (AQI < 100)Fall/Winter● (4.4)● (17.4)● (3.7)● (63.8)[38]
Light pollution (101 < AQI < 150)● (3.4)● (1.7)● (<0.4)● (50.3)● (41.3)
Moderate pollution(150 < AQI < 200)● (1.0)● (17.6)● (<0.4)● (52.2)● (26.3)
Heavy pollution (201 < AQI < 300)● (8.1)● (1.5)● (<0.4)● (81)
PM2.5 (Xinxiang, China)Ion S5™ XL SequencingSpring● (1.7)● (24.3)● (5.2)● (3.4)● (23.9)● (37.4)[64]
Summer● (6.9)● (16.9)● (7.5)● (0.5)● (17.8)● (34.2)
Fall● (0.7)● (13.9)● (12.0)● (3.0)● (23.8)● (41.8)
Winter● (1.7)● (9.9)● (15.8)● (9.5)● (26.6)● (28.7)
PM2.5 (Yucheng, China)Illunina Miseq96.3 μg/m3Summer● (12.3)● (2.8)● (8.6)● (4.7)● (70.0)[50]
PM2.5 (Guilin, China)Illunina Miseq15-176 μg/m3Winter● (10.2)● (64.7)● (22.4)[68]
PM2.5 (Beijing, China/ Seoul, Korea/ Nagasaki, Japan)Illunina Miseq81.4 μg/m3 in BeijingAll season● (18.7)● (3.0)● (2.2)● (20.8)● (51.9)[70]
52.8 μg/m3 in Seoul● (9.75)● (2.7)● (1.1)● (23.9)● (60.2)
15.5 μg/m3 in Nagasaki● (11.3)● (2.5)● (2.2)● (16.7)● (65.2)
Average● (13.6)● (2.8)● (1.9)● (20.5)● (58.6)
PM2.5 (Jinan & Weihai, China)Illunina Miseq69.9 μg/m3 in Jina (inland); 36.6 μg/m3 in Weihai (coastal)Winter●●●[51]
PM2.5 (Xi’an, China)Illunina MiseqNon-pollution (22-70 μg/m3 )Fall/Winter● (7.81 at 229.5 m)● (12.9 at 1.5 m; 17.9 at 100 m; 13.8 at 229.5 m)● (58.6 at 1.5 m; 51.0 at 100 m; 78.2 at 229.5 m)[46]
Pollution (105-195 μg/m3 )Fall/Winter● (25.8 at 1.5 m; 17.6 at 100 m; 15.0 at 229.5 m)● (40.6 at 1.5 m; 59.6 at 100 m; 53.0 at 229.5 m)
PM2.5/PM10 (Beijing in China)Illunina Miseq44 μg-PM2.5/m3
63 μg-PM10/m3		All season● (20.1)● (4.8)● (24.4)● (17.4)● (29.4)[66]


Table 9 . Dominant bacterial genus in aerosol and PM samples.

Sample (Sampling site)MethodPollutionSeasonDominant genusRef.
Aerosol (Toposphere, Japan)Pyrosequencing1.05 – 8.84 ×106 particles/m3All seasonBacillus; Streptococcus; Sphingomonas; Pseudomonas; Pseudoxanthomonas; Variovorax; Methylobacterium; Owenweeksia; Brevibacterium[19]
Aerosol (North Sea-Baltic Sea)PyrosequencingNo informationSummerSphingomonas (17.0); Cyanobacterium (1.5)[79]
Aerosol (Toyama, Japan)DGGENo informationSpringPseudomonas; Anaerococcus; Propionibacerium; Cyanobacterium; Delftia[48]
SummerBacillus; Staphylococcus; Methylobacterium; Pseudomonas; Friedmanniella; Weissella; Ochrobactrum
FallPseudomonas; Acinetobacter; Cyanobacterium; Chryseibacterium; Bacillus; Methylobacterium; Amoebophilus; Sphingomonas; Staphylococcus; Corynebacterium; Pantoea; Exiguobacterium; Mucilaginibacter
WinterPantoea; Bacillus; Cyanobacterium; Agrobacterium; Rubellimicrobium; Paracoccus; Pseudomonas; Acidobacteria
PM2.5 (Beijing-Tianjin-Hebei, China)Illunina Miseq35-194 μg/m3SpringStreptophyta; Paracoccus; Planomicrobium; Massilia; Kocuria; Arthrobacter; Deinococcus; Rubellimicrobium; Sphingomonas; Actinetobacter; Pseudomonas; Exiguobacterium; Psychrobacter; Shigella[49]
PM2.5 (Beijing, China)Illunina Miseq0 – 300 air quality index (AQI)aSpringBlastococcus (3.0); Kocuria (2.7); Sphingomonas (1.7); Rubellimicrobium (1.7)[62]
SummerPseudolabrys (20.4); Bacillus (2.4); Blastococcus (2.3); Segetibacter (1.5)
FallClostridium (10.7); Bacillus (7.3); Clostridium cluster XI (6.8); Sphingomonas (5.7); Methylobcterium (3.7)
WinterPseudolabrys (13.5); Kocuria (3.2); Blastococcus (3.1); Staphylococcus (2.6)
PM2.5 (Beijing, China)Illunina Miseq0 – 300 air quality index (AQI)aSpringPlanococcus (8.9); Kocuria (5.4); Bacillus (2.0)[59]
SummerKocuria (7.3); Paracoccus (6.8); Bacillus (2.9)
FallSphingomonas (6.5); Kocuria (5.9); Paracoccus (5.7)
WinterKocuria (5.2); Sphingomonas (3.5); Paracoccus (2.7)
PM2.5/PM10/TSP (Hangzhou, China)Ion Torrent Sequencing22-236 μg-PM2.5/m3
37-249 μg-PM10/m3		WinterThiobacillus (2.6); Methylobacterium (2.5); Rubellimicrobium (1.8); Paracoccus (1.7)[44]
PM2.5 (Beijing, China)Illunina MiseqNon-Pollution ~ Severe pollution (AQI > 300)SpringRalstonia; Kocuria; Planococcus; Arthrobacter[67]
Summer/Fall/WinterRalstonia; Kocuria; Paracoccus; Rubellimicrobium; Blastococcus; Sphingomonas
PM2.5 (Jinan, China)Illunina MiseqNon pollution(AQI < 100)Fall/WinterOchrobactrum (37.1); Vibrionimonas (11.2)[38]
Light pollution (101 < AQI < 150)Fall/WinterBacillus (21.9); Lactococcus (17.9); Ochrobactrum (13.2); Burkholderia (9.1)
Moderate pollution (150 < AQI < 200)Fall/WinterLactobacillus (25.9); Prevotella (9.2); Pelomonas (8.5); Ralstonia (7.8)
Heavy pollution (201 < AQI < 300)Fall/WinterCupriavidus (22.9); Ralstonia (16.9); Leifsonia (6.1); Pelomonas (5.0); Enterococcus (2.5)
PM2.5 (Xinxiang, China)Ion S5™ XL SequencingSpringLactobacillus (7.0); Paracoccus (2.9); Pseudomonas (0.5); Eschericia-Shigella (0.2)[64]
SummerLactobacillus (3.6); Pseudomonas (1.1); Eschericia-Shigella (1.0); Enhydrobacter (0.5); Bifidobacterium (0.4); Akkermansia (0.3)
FallEnhydrobacter (4.1); Parabacteroides (4.0); Eschericia-Shigella (3.4); Bifidobacterium (3.1); Lactobacillus (2.7); Pseudomonas (2.2)
WinterPseudomonas (5.3); Akkermansia (2.2); Eschericia-Shigella (2.0); Lactobacillus (1.3); Bifidobacterium (1.0)
PM2.5 (Yucheng, China)Illunina Miseq96.3 μg/m3
Before biomass burning		SummerPseudomonas (17.5); Stenotrophomonas (4.0); Pantoea (2.8); Massilia (1.8); Bacillus (1.3); Arthrobacter (1.0)[50]
After biomass burnimgSummerPseudomonas (26.5); Stenotrophomonas (6.7); Bacillus (1.8); Massilia (0.6); Arthrobacter (0.5)
PM2.5 (Guilin, China)Illunina Miseq15-176 μg/m3WinterBacillus (30.8); Lactococcus (15.5); Pseudomonas (14.0); Ralstonia (1.8); Lactobacillus (1.4); Sphingomonas (1.2); Carnobacterium (1.0)[68]
PM2.5 (Jinan & Weihai, China)Illunina Miseq69.9 μg/m3 in Jina (inland); 36.6 μg/m3 in Weihai (coastal)WinterStaphylococcus; Cyanobacteria; Lactobacillus; Deinococcus; Enbydrobacter; Ralstonia; Bacillus; Comamonas; Sphingomonas[51]
PM2.5 (Xi’an, China)Illunina MiseqNon-pollution (22-70 μg/m3 )Fall/Winter
1.5 m		Thermus (16.2); Acinetobacter (14.8); Pseudomonas (14.8); Sphingomonas (7.0); Anoxybacillus (6.8)[46]
100 mPseudomonas (15.5); Thermus (14.0); Acinetobacter (13.3); Anoxybacillus (7.7); Sphingomonas (4.2)
229.5 mAcinetobacter (27.4); Pseudomonas (19.7); Sphingomonas (6.3); Thermus (0.3); Anoxybacillus (0.2)
Pollution (105-195 μg/m3 )Fall/Winter
1.5 m		Thermus (23.2); Pseudomonas (13.3); Anoxybacillus (12.6); Acinetobacter (9.8); Sphingomonas (2.8)
100 mPseudomonas (19.0); Acinetobacter (16.9); Thermus (12.6); Anoxybacillus (5.6); Sphingomonas (5.6)
229.5 mAcinetobacter (23.2); Thermus (17.6); Pseudomonas (11.9); Anoxybacillus (8.4); Sphingomonas (3.5)
PM2.5/PM10 (Beijing in China)Illunina Miseq44 μg-PM2.5/m3
63 μg-PM10/m3		All seasonSphingomonas (3.3); Bacillus (3.1); Methylobcterium (1.9); Arthrobacter (1.9); Melittangium (1.9); Streptomyces (1.3); Paracoccus (1.1); Kocuria (1.0)[66]


Figure 7.Comparison of relative abundances of bacteria at phylum level.

세균 문 수준의 상대적 우점도는 계절에 따라 변화할 수 있다. 미국의 콜로라도에서 계절별로 에어로졸 시료를 채취하여 세균의 메타게놈을 분석한 결과, Proteobacteria의 비율은 봄(64.4%)과 여름(60.3%)에 비해 가을(44.1%)과 겨울철(59.7%)에 약간 낮아졌다[40]. 이에 비해 Firmicutes의 비율은 봄(6.1%)과 여름(4.9%)에 비해 가을(19.6%)과 겨울철(8.4%)에 증가하는 경향이 있었다[40]. 중국의 Xinxiang에서채취한 PM2.5의 세균 메타게놈의 계절적 특성을 조사한 결과, 봄, 여름, 가을, 겨울로 갈수록 Bacteroidetes의 비율은 점점 증가하나, Actinobacteria의 비율은 점점 감소하는 경향이 있었다[64]. 세균의 메타게놈에 미치는 계절적 영향을 파악하기 위해, Table 8에 정리한 결과를 계절별로 정리하여Fig. 8에 도시하였다. Proteobacteria의 비율은 봄(중간값54.0%)과 여름(54.8%)에 비해, 가을과 겨울에는 각각 41.8%와 30.5%로, 기온이 낮아짐에 따라 점점 낮아지는 경향이 있었다. 이와 반대로, Firmicutes의 비율은 여름(6.9%)에 비해, 봄과 가을에는 각각 15.0%와 19.7% 그리고 겨울에는 21.1%로 기온이 낮아짐에 따라 높아지는 경향이 있었다. Cyanobacteria의 비율은 봄(3.4%)과 여름(0.5%)에 비해 가을(24.0%)과 겨울(13.8%)에 높았다. 4계절 중에서는 Bacteroidetes의 비율은 봄에 가장 높았고(19.4%), Actinobacteria의 비율은 가을에 가장 높았다(18.5%).

Figure 8.Comparison of relative abundances of bacteria at genus level. Acido., Acidobacteria; Actino., Actinobacteria; Bacter., Bacteroidetes; Cyano., Cyanobacteria; Firmi., Firmicutes; Proteo., Proteobacteria. (A) Spring, (B) Summer, (C) Fall, (D) Winter.

대기오염 정도도 세균 메타게놈의 특성에 영향을 미칠 수 있다. Ji et al. (2019)는 중국 Jinan에서 대기오염 정도에따라 PM2.5의 세균 메타게놈 특성을 분석한 결과, Cyanobacteria의 비율은 대기오염도가 증가함에 따라 검출한계 이하로 낮아져, 이 문은 대기오염에 매우 민감한 것을알 수 있었다[38]. 그런데, Proteobacteria의 비율은 대기오염도가 증가함에 따라 점점 감소하다가(AQI 100 이하에서는 63.8%이었으나, AQI가 150에서 200 사이일 때 26.3%),대기오염도가 매우 높아지면(AQI 200에서 300 사이) Proteobacteria의 비율이 81%로 급격하게 증하였다. 이러한경향은 Actinobacteria의 비율 변화에서도 관찰되었다. AQI가 100 이하 조건에서 4.4%이었던 Actinobacteria의 비율이AQI가 150에서 200 사이 조건에서는 1.0%까지로 감소하였다가, AQI가 200 이상이 되면 그 비율이 8.1%로 급증하였다. 한편, AQI가 100 이하이거나, AQI가 200이상인 경우에는 Firmicutes의 비율은 검출한계 이하로 나타났으나, AQI가 100에서 200 사이의 중간 정도의 대기오염 조건에서는Firmicutes의 비율이 약 50%로 매우 높았다.

Bai et al. (2021)은 중국 Xi'an에서 고도 1.5 m, 100 m 및229.5 m에서 PM2.5 시료를 채취하여 세균 메타게놈을 분석하였다[46]. PM2.5 농도가 낮은 쾌적한 날, 고도 1.5 m와100 m에서 채취한 PM2.5 시료의 Proteobacteria 비율은 각각 58.6%와 51.0%이었으나, 고도 229.5 m에서 채취한 시료의 Proteobacteria 비율은 78.2%이었다. PM2.5 농도가 높은날에 고도 1.5 m, 100 m 및 229.5 m에서 채취한 PM2.5 시료의 Proteobacteria 비율은 각각 40.6%, 59.6% 및 53.0%이었다. 쾌적한 날에 고도별로 채취한 PM2.5 시료의Firmicutes의 비율은 12.9-17.9%이었다. 그런데, 오염이 심한 날에 채취한 PM2.5 시료의 Firmicutes의 비율은 고도가높아질수록 감소하는 경향이 있었다. 즉, Firmicutes의 비율은 고도 1.5 m에서는 25.8%이었으나, 고도 229.5 m에서는15.0%이었다.

세균 메타게놈을 속(genus) 수준으로 비교해 보면(Table 9), 시료를 채취한 지역과 계절 및 대기오염도에 따라 우점세균의 종류는 매우 다양하지만, 우점종으로 분석된 세균은 Bacillus [19, 38, 48, 68], Sphingomonas [59, 66, 79], Pseudomonas [46, 48, 50, 64], Streptophyta [49], Pseudolabrys [62], Clostridium [62], Planococcus [59], Kocuria [59, 67], Thiobacillus [44], Paracoccus [67], Ochrobacterum [38], Lactococcus [38, 68], Lactobacillus [38, 64], Cupriavidus [38], Enhydrobacter [64], Staphylococcus [51], Thermus [46] 및 Acinetobacter [46] 등이다.

계절에 따라 PM 시료의 세균 우점종이 바뀌는데, 중국 베이징에서 봄, 여름, 가을, 겨울에 채취한 PM2.5 시료의 우점종은 각각 Blastococcus, Pseudolabrys, Clostridium 및 Pseudolabrys이었다[62]. 그런데 Du et al. (2018)이 중국 베이징에서 계절별로 PM2.5 시료를 채취하여 우점종을 분석한결과, 봄, 여름, 가을 및 겨울의 우점종은 각각 Planococcus, Kocuria, Sphingomonas 및 Kocuria이었다[59]. 중국 Xinxiang에서 계절별로 채취한 PM2.5의 봄과 여름의 우점종은 Lactobacillus이었고, 가을과 겨울의 우점종은 각각Enhydrobacter와 Pseudomonas이었다[64]. 대기질도 세균우점종에 영향을 미치는데, Ji et al. (2019)는 중국 Jinan에서 대기오염도에 따라 PM2.5 시료를 채취하여 우점종을 분석하였다[38]. 그 결과, 오염이 없는 쾌적한 날에 채취한 PM2.5의 우점종은 Ochrobacterum이었으나, 대기질이 나빠짐에 따라 우점종이 Bacillus, Lactobacillus, 그리고 Cupriavidus로 변화하였다. Bai et al. (2021)은 중국 Xi'an에서 고도별로 우점종 차이를 분석하였는데, 고도 1.5 m, 100 m 및 229.5 m에서 채취한 PM2.5의 우점종은 각각 Thermus, Pseudomonas 및 Acinetobacter이었다[46]. 각 고도에서의 우점종은 대기질이 좋은 날과 나쁜 날에 상관없이동일하였다.

Proteobacteria와 Actinobacteria는 매우 건조하며 자외선이 강한 환경에도 견딜 수 있기 때문에[100], 대기오염이 악화된 이후에도 감소하지 않고 오히려 환경에 적응한 후에증가하였다[66]. 대기오염이 심한 조건에서는 Bacillus, Sphingomonas, Rubellimicrobium 및 Kocuria 등의 우점도가 높은데, 이들은 가혹한 환경에서 생존이 가능하기 때문으로 추정된다[51].

Bacillus는 가혹한 환경에 적응하기 위해 내생포자를 생성할 수 있으며, 대기 먼지[101]와 토양[102]에서 널리 발견되는 휴면 상태로 장기간 생존 가능하다. Lactococcus는 일반적으로 토양에 서식하며[39], 이는 대기 세균의 주요 공급원이었다[103]. Pseudomonas 는 병원성을 지닌 종도 있지만[97], 이 세균은 토양 생태계의 영양 순환에서 중요한 역할을 한다[102]. Sphingomonas는 일반적으로 토양에서 발견되며 극한 환경에서 서식할 수 있다[104, 105]. Lactobacillus는 대기 먼지[106] 및 PM2.5[103]에서도 많이 발견되는 세균이다.

세균은 세포벽 구조에 따라 그람 양성균과 그람 음성균으로 구분된다. 대기 중 세균에서 그람 양성균의 비율은 58.5-89%, 그람 음성균의 비율은 11-32%로, 그람 양성균의 비율이 1.5배 이상 높았다[34, 68, 107, 108]. 이러한 결과는 그람 양성균이 그람 음성균보다 대기와 같은 가혹한 환경에서더 강한 생존 능력을 가지고 있음을 시사한다[103].

대기 환경 중 곰팡이 메타게놈 특성

Go to

에어로졸 및 PM 시료의 세균 메타게놈 정보에 비해 곰팡이의 메타게놈 정보는 적지만, 독일, 한국 및 중국 등에서 채취한 시료의 곰팡이 메타게놈 분석 결과를 Table 10에 정리하였다.

Table 10 . Dominant fungal phylum in aerosol and PM samples.

Sample (Sampling site)MethodPollutionSeasonFungal phylumFungal genusRef.
Ascomycota (%)Basidiomycota (%)Glomeromycota (%)Zygomycota (%)
Aerosol (Mainz, Germany)PyrosequncingNo informationAll season● (34.0)● (64.0)-[65]
TSP (Seoul, Korea)T-RFLPNo informationWinter● (48.8)● (39.0)● (7.5)-[47]
PM2.5 (Gwangju, Korea)Illunina Miseq35.7 μg/m3
48.9 μg/m3		Spring
Spring		● (22.0)
● (81.0)		-[99]
PM2.5 (Beijing, China)Illunina Miseq0 – 300 air quality index (AQI)aAll season● (74.7)● (3.4)Epicoccum (7.0); Mycosphaerella (5.5); Selenophoma (3.5); Penicillium (2.3)[62]
PM2.5 (Beijing, China)Illunina Miseq0 – 300 air quality index (AQI)aAll season● (95.4)● (1.5)● (0.1)Epicoccum (6.0, dominant in fall); Penicillium (3.4, dominant in winter); Selenophoma (3.3); Mycosphaerella (2.5, dominant in spring and summer); Cladosporium (1.7); Aspergillus (1.7); Sarocladium (1.3)[59]
PM2.5 (Beijing, China)Illunina MiseqNon-Pollution ~ Severe pollution (AQI > 300)All season●Mycosphaerella (dominant in spring and summer); Epicoccum (dominant in fall and winter); Penicillium[67]
PM2.5 (Yucheng, China)Illunina Miseq96.3 μg/m3
Before biomass burning		Summer● (86.0)● (5.0)Alternaria (53.3); Acremonium (0.02)[50]
After biomass burningSummer● (86.0)● (5.0)Alternaria (61.1); Acremonium (0.07)
PM2.5 (Nanchang, China)Illunina Miseq27.7-37.5 μg/m3
22.9 μg/m3 in forest		Spring
Spring		● (90.4)
● (90.4)		● (9.7)
● (9.7)		Ascochyta; Alternaria; Torula; Coprinellus
Fomitopsis; Arthrinium; Phlebia; Erysiphe; Malassezia		[61]
PM2.5 (Xi’an, China)Illunina MiseqNo information
Mountain		Spring●●Itersonilia (7.7); Malassezia (6.3); Auricularia (4.1)[69]
Summer●●Protodontia (7.9); Trametes (6.0); Amanita (4.9)
Fall●●Talaromyces (3.7); Penicillium (2.9); Cordyceps (2.6)
Winter●●Talaromyces (9.1); Cutaneorichosporon (7.2); Microsporum (5.1)
UrbanSpring●●Phoma (5.1); Mortierella (2.8); Bullera (2.4)
Summer●●Cryptococcus (11.1); Trichosporon (7.0); Aspergillus (6.7)
Fall●●Trechispora (5.0); Trametes (3.3); Aspergillus (3.3)
Winter●●Cutaneorichosporon (6.7); Talaromyces (4.0); Aspergillus (3.6)
PM2.5/PM10 (Beijing in China)Illunina Miseq44 μg-PM2.5/m3
63 μg-PM10/m3		All season● (78.9)● (19.4)Cladosporium (21.9); Alternaria (20.9); Schizophyllum (6.6); Mycosphaerella (4.7); Talaromyces (3.7); Epicoccum (2.3); Aspergillus (2.2); Irpex (2.2); Filobasidium (1.9); Curvularia (1.7); Fusarium (1.5); Nigrospora (1.3)[66]


대부분 시료의 곰팡이는 Ascomycota(자낭균류)와Basidiomycota(담자균류) 문에 속하였다. 시료 종류에 따라Ascomycota와 Basidiomycota 비율에 차이가 있지만, 전체적인 특성을 파악하기 위해 Table 10의 결과를 이용하여Ascomycota와 Basidiomycota의 상대적 우점도의 분포 및평균값과 중간값을 계산하였다(Fig. 9). Ascomycota의 상대적 우점도의 평균값과 중간값은 각각 67.9 ± 26.3% 및 78.9%이었고, Basidiomycota의 우점도의 평균값과 중간값은20.3 ± 23.3% 및 9.7%이었다.

Figure 9.Comparison of relative abundances of fungi at phylum level.

에어로졸과 PM 시료의 곰팡이 우점종은 시료를 채취한지역과 계절 및 대기오염도에 따라 매우 다양하지만, 주요우점종은 Epicoccum [59, 62, 67], Mycosphaerella [67], Alternaria [50], Ascochyta [61], Fomitopsis [61], Itersonilia [69], Protodontia [69], Talaromyces [69], Phoma [69], Cryptococcus [69], Trechispora [69], Cutaneorichosporon [69] 및 Cladosporium [66] 등이었다.

중국 Xi'an의 산지에서 계절별로 PM2.5 시료를 채취하여우점 곰팡이를 분석한 결과, 봄과 여름의 우점종은 각각Itersonilia와 Protodontia이었으나, 가을과 겨울의 우점종은Talaromyces로 동일하였다[69]. 계절에 따라 PM 시료의 세균 우점종이 바뀌는데, 중국 베이징에서 봄, 여름, 가을, 겨울에 채취한 PM2.5 시료의 우점종은 각각 Phoma, Cryptococcus, Trechispora 및 Cutaneorichosporon이었다[69].

Qi et al. (2020)은 PM 농도와 곰팡이 종 풍부도 사이에는음의 상관관계가 있다고 보고하였다[69]. 바이오에어로졸 농도 수준과 PM 사이에 음의 상관관계가 있었고[109], Sporisorium, Trametes, Cladosporium 및 Fusarium은안개가 없는 날에 높은 우점도을 보였다[110]. 또한, Aspergillus, Aureobasidium 및 Penicillium은 안개가 없는날에만 검출되었다[35]. 그러나, Li et al. (2017)은 안개가 자욱한 날의 생존 가능한 곰팡이의 평균 농도가 안개가 없는날보다 높다고 보고하였다[111]. 또한, 다른 연구에서는 안개가 자욱한 날에 총 공기 중 미생물 농도가 크게 증가한 것으로 보고하였다[41, 112]. 대기오염이 심한 조건에서는Alternaria는 오염이 증가함에 따라 증가했으며 Cladosporium도 상대적으로 높은 비율을 유지하였다.

AM 메타게놈에 영향을 미치는 환경인자 영향

Go to

AM 메타게놈의 미생물 종류 및 농도에 영향을 미치는 인자는 크게 기후적 인자, 지역적 인자, 환경오염 인자 및 생물적 인자로 구분할 수 있다[1, 3, 4]. 기후적 인자에는 습도,기온, 풍향, 풍속, 강수량 및 태양 복사 등이, 지역적 인자에는 지리적 위치, 고도 및 토지이용도 등이 포함된다. 환경오염 인자에는 SOx, NOx, CO, O3 및 PM 농도 등이, 생물적 인자에는 세균과 세균, 곰팡이와 곰팡이, 그리고 세균과 곰팡이 사이의 상호작용 등이 포함된다. 시료를 채취한 지역의차이에 따라 세균과 곰팡이 농도 차이가 100배 이상 생기는데[113], 채취 시료 주변의 다양한 환경과 미생물 공급원이AM의 농도와 활성 차이를 유발한다. 또한, 대기 중 세균의농도는 인간의 활동에 크게 영향을 받는 것으로 보고되고 있다. 대기 중 세균 농도의 일일 변화를 조사한 연구 결과에 의하면, 출퇴근 시간인 오전 7시에서 9시 사이와 오후 5시에서6시 사이 세균 농도가 가장 높고, 오후 1시에서 2시 사이에세균 농도가 가장 낮은 것으로 보고하였다[114-116]. AM의메타게놈 특성에 미치는 기후적 인자와 환경오염 인자의 영향을 아래 절에 보다 자세히 정리하였다.

기후적 인자 영향

햇빛 강도, 온도 및 일사량은 바이오에어로졸의 농도에 영향을 미친다. 햇빛이 있는 주간의 곰팡이 농도는 야간보다높은 경향이 있으며, 햇빛은 곰팡이의 종 풍부도를 높이는데기여하는 것으로 보고되고 있다[117]. 기온은 바이오에어로졸의 생장과 크기에 영향을 미친다[12]. 기온과 바이오에어로졸 농도 사이의 상관관계는 지리적 위치 및 특정 기상 조건에 따라 달라진다. 또한, 바이오에어로졸을 구성하는 미생물 종의 차이에 따라 기온을 비롯한 기후적 인자들에 대한생리적 내성에는 차이가 있기 때문에[67] 바이오에어로졸의거동과 기후적 인자의 사이의 상관관계를 도출하기 매우 어려워진다. 특정 기상 조건에서 기온은 바이오에어로졸의 농도와 강한 양의 상관관계가 있었다[43, 118]. 그러나 일부 지역에서는 바이오에어로졸의 세균과 곰팡이의 다양성과 기온사이에 유의미한 음의 상관관계[67, 119] 혹은 통계적으로유의하지 않은 상관관계를 보였다[44, 45].

일반적으로 따뜻하고 습한 기후에서 바이오에어로졸의 종풍부성이 높은 경향이 있는데, 이는 풍부한 태양 에너지와물이 있는 환경이 AM의 생리적 기능을 활성화시키기 때문에 종 풍부도가 증가한다고 추정되고 있다[4]. 그런데, 춥고건조한 환경은 미생물 특히 세균 생장에는 불리한 조건이므로[120], 바이오에어로졸의 종 풍부도가 상대적으로 낮은 것으로 추정되고 있다[4]. 겨울의 매우 낮은 온도는 세포막의유동성을 감소시키고 세균의 활성을 저하시킨다. 세균의 최소 생장 온도는 세포막의 지방산 조성에 따라 크게 달라질수 있다. 봄에 기온이 상승하게 되면 미생물의 증식이 촉진되지만, 여름에는 고온과 강한 자외선으로 인해 세균의 생장이 저해 되거나 사멸되기 때문에, 고온과 자외선은 대기 중세균 농도와 음의 상관관계를 보였다[117, 119, 121, 122]. 그런데 곰팡이와 포자는 대기의 극한 온도 범위와 자외선 조건에서도 생존 할 수 있다. 인도의 Jodhpur지역에서 여름에채취한 에어로졸 시료의 우점종은 Aspergillus sp.이었다[123]. 또한, 인도에서 곰팡이 포자 농도는 일반적으로 기온이 높고 비가 오지 않은 4-5월에 가장 높았다[117, 124, 125]. 기온이 약 24℃보다 높으면 PM 표면의 화학 반응이강화되고 더 많은 독성 화합물이 형성되기 때문에, AM의 생존이 감소하여[126, 127], PM 시료의 미생물 활성은 여름에저하되는 것으로 사료된다.

많은 연구 결과에 의하면, 기온과 세균 및 곰팡이는 유의한 양의 상관관계가 있으며, 높은 온도는 곰팡이 포자에 대한 최적의 조건이지만, 낮은 온도는 곰팡이 발생의 제한 요소로 보고하였다[1, 128-130]. 그러나, 기온과 세균의 다양성 사이에는 음의 상관관계를 보인다는 보고도 있다[131-133]. PM2.5 농도가 300 µg/m3 이상일 때 AM과 기온 사이에 음의 상관성을 보이는데, 이는 고온이 독성 화합물의 방출을 촉진하고 PM내에서 발생하는 화학 반응을 촉진하기때문으로 추정되고 있다[37, 127].

기온은 곰팡이 종 구성에 영향을 줄 수 있는 핵심 인자인데, 고온은 전도성 공기의 이동을 가속화하고 곰팡이의 생장및 대기로의 확산을 촉진할 수 있다[1, 134]. 일부 연구에서는 포자 수준과 고온 사이에 양의 상관 관계가 있다고 보고하였다[126, 135, 136].

상대습도는 주어진 온도에서 물의 평형 증기압에 대한 수증기 분압의 비율이다. 상대습도는 AM 농도, 다양성, 군집구조 등에 상당한 영향을 미치며, 온도와 함께 그 영향이 더크게 작용하기도 한다[4, 12, 110]. 일반적으로 세균과 곰팡이의 농도와 활성은 상대 습도와 양의 상관성을 갖는 경향이 있다. 세균의 생장은 상대 습도 65% 전후에서 최적이었고, 상대 습도가 너무 높으면(95% 이상) 대기 중 세균의 분산이 저해 받고, 상대 습도가 너무 낮으면 세균 생장이 억제되었다[121].

곰팡이는 상대습도가 감소할 때 곰팡이 포자 방출이 증가하였다[12]. 일부 연구에 의하면 곰팡이는 65-85% 상대 습도에서 가장 높은 농도를 보였다[137]. 그런데, 상대습도가너무 높으면 대기 중 곰팡이의 분산이 억제되기 때문에 습도와 곰팡이 농도는 음의 상관관계를 보이기도 하였다[45, 119]. Qi et al. (2020)는 상대습도가 곰팡이 종 풍부도와 음의 상관관계를 보였다고 보고하였다[69]. Botryosphaerta, Coccomyces 및 Dictyosporium의 상대우점도는 상대습도와음의 상관관계를 나타냈다[138]. 상대습도가 높을 때 포자는젖은 표면에 더 잘 달라붙어 공급원에서 미생물의 방출을 감소시킨다[139]. 또한 습도가 높은 조건에서 대기 중에 부유하는 생물학적 입자는 수증기를 더 많이 감싸고 흡수하여 무게와 크기가 증가하여 지면에 퇴적될 가능성이 높아진다. 한편, 일부 곰팡이 종(Alternaria, Cladosporium 등)은 상대 습도가 낮고 고온인 조건에서 생존 가능하였다[140, 141]. 이와 같이 상대습도가 미생물 방출에 미치는 영향은 명확하지않으며, 미생물 종류에 따라 차이가 있음을 알 수 있다[139].

풍향과 풍속은 건조 포자의 방출 및 재현탁에 영향을 미칠 수 있고[142], 미생물의 부유를 촉진하여 AM의 농도와 종다양성을 증가시킬 수 있다[12, 33, 143, 144]. 그러나, 바람은 대기 희석 효과로 AM 농도를 감소시킬 수 있다[45, 67, 144-146]. 풍속과 AM의 상관관계에 대한 서로 상반된 결과들이 보고되고 있는데, 이는 지역, 미생물 공급원 및 기타 요인 등의 영향에 기인한 것으로 추정된다[147-152].

강우는 바이오에어로졸의 생장, 크기 및 농도에 가장 중요하게 영향을 미치는 인자 중의 하나이다. 비가 내리고 있는중이나 내린 직후에는 대기 중 PM의 크기가 감소하여 구름응결 핵으로 작용하거나 얼음 핵이 되어 PM 형성이 더욱 더활성화된다[153-155]. 크기가 작아진 PM은 더 먼 지역으로이동할 수 있으므로 대기 중에서 체류하는 시간이 길어진다[118]. 또한, 강수 현상으로 인해 지상으로부터 대기로 바이오에어로졸의 방출이 활발해 질 수 있다[155-158]. 그러나비가 내리면 바이오에어로졸의 습식 침적으로 인해 대기 중바이오에어로졸 감소 효과를 가져 올 수 있다[66, 150].

대기오염물질 영향

대기 오염 물질은 세균 군집 구조에 영향을 미치는 주요요인이다[49]. 대기질이 우수하거나 양호할 때는 대기오염이아주 심하지 않을 때보다 미생물 활성이 높았으나, 대기질이악화 되면 미생물 활동이 급격히 증가하는 경향이 있었다[66].일산화탄소, 이산화황, 이산화질소 및 오존 등과 같은 대기오염물질은 농도에 따라 바이오에어로졸에 영향을 미친다.여러 종류의 대기오염물질 간 상호작용은 AM 농도에 영향을 미쳤다[159]. 속 수준에서 미생물의 상대적 풍부함은 일산화탄소 농도와 양의 상관관계가 있었고[44], 이산화황 농도와 AM 다양성 사이에도 양의 상관관계가 있었다[44, 67].이산화질소는 다른 대기환경 요인보다 세균 농도에 더 많은영향을 미쳤다[64]. 세균의 군집 구조에 미치는 이산화질소의 영향은 거의 적었고, 유의미한 상관관계가 없었다[44, 64].오존은 곰팡이의 종 풍부도와 다양성에 영향을 미치는 또 다른 중요한 요소이다. 산화능이 강한 오존 농도와 AM 농도사이에 음의 상관관계가 있지만[44, 45, 64], 일부 연구에서는 오존 농도와 세균의 OTU 수 사이에 양의 상관관계를 보이기도 하였다[44]. 이와 같이 오존의 영향을 약화시키는 기타 요인이 있는 경우 오존 농도와 곰팡이 다양성 사이에 다양한 상관관계가 보일 수 있다[69]. 황, 질소 및 탄소는 생명의 기본 요소이기 때문에 이산화황, 이산화질소 및 일산화탄소가 AM의 영양원으로 제공될 수 있으나, 이들이 황산과 같은 독성 오염 물질을 생성하여 AM의 생장을 억제할 수도 있다[67]. AM의 거동과 메타게놈 특성은 대기 중 PM의 크기및 농도에 영향을 크게 받는다. AM은 주로 크기가 큰 PM의형태로 분포되어 있고[41, 160], PM10 중 미생물 함량은PM2.5 보다는 높았다[127]. 그러나, PM2.5의 병원성 세균함량은 PM10의 병원성 세균 함량보다 높았다[60, 161]. Chen et al. (2021)은 중국 Beijing에서 PM2.5와 PM10을채취하여 미생물 활성을 측정한 결과, 두 시료 사이에 유의미한 미생물 활성의 차이는 없었다[66]. 중국 Xi'an에서 채취한 PM2.5와 PM10의 미생물 활성도 유의미한 차이가 없었다[162]. 또한, Qin et al. (2020)는 Beijng에서 채취한PM2.5 및 PM10 시료의 세균 함량은 각각 95.5% 및 93.0%로 큰 차이가 없었다고 보고하였다[163].

PM 농도와 곰팡이 군집 다양성 사이에는 일관된 상관 관계가 보이지 않아, 일부 미생물의 성장을 억제하거나 촉진할수 있으며 따라서 군집 조성의 변화를 유발할 수 있다[164]. PM2.5 농도가 증가할수록 세균의 종 풍부도와 다양성이 낮아졌다[165, 166]. PM2.5에 함유된 미량 금속, 수용성 음이온과 양이온은 PM2.5의 미생물 군집 구조에 영향을 미칠 수 있다[167]. 수용성 이온 물질인 SO42- 및 NO3- 은 미생물의생존과 생장에 필요하지만[112], Zn, Pb, As 및 Cu 등과 같은 중금속은 미생물에게 독성이 될 수 있다[3]. 예를 들면, 안개가 자욱한 날 PM2.5의 중금속 농도는 안개가 없는 날보다 약 2.5-3배 더 높은데[168], PM에서 방출되는 중금속은활성 산소종(ROS), 특히 수산기(hydroxyl radical; HO-)의생성을 촉진하여 세포에 광범위한 손상을 일으킬 수 있다[169]. 따라서, PM이 증가하면 PM에 부착된 유독성 화학 물질도 증가하여 그 독성 영향을 초래할 수 있다. 또한, 안개가 자욱한 날 다른 미생물 개체군의 과도한 성장은 다른 곰팡이 군집의 성장을 억제할 수 있다. 안개가 없는 날에는 다른 종류의 미생물 사이 경쟁이나 저해 작용이 낮아져 군집내에서 다양한 종이 공존할 수 있다. 따라서 공기 중 PM의독성 화학 성분이 공기 중 곰팡이 다양성에 미치는 영향은향후 연구에서 규명되어야 한다.

결론

Go to

본 논문에서는 실외 대기 환경의 바이오에어로졸 혹은 PM시료의 세균과 곰팡이 메타게놈 특성을 정리하였다. 시료 채취 지역 및 환경 조건 특성별 대기 중 세균과 곰팡이 농도를요약 정리하고, 에어로졸과 PM 시료의 세균과 곰팡이의 메타게놈 특성을 조사하기 위한 비배양법 기반 분석방법을 정리하였다. 또한, 세균과 곰팡이의 메타게놈 특성과 다양성 및특성에 미치는 환경 인자의 영향을 고찰하였다. 대기 중 미생물의 생존, 생장과 분산은 지역 기상 조건 및 대기 오염 물질에 의해 크게 영향을 받았다. 일반적으로 기온이 상승함에 따라 AM 농도는 증가하지만, 여름에는 고온과 강한 자외선의 영향으로 AM 농도가 감소하였다. 습도와 미생물 농도는양의 상관성을 보이나, 습도가 너무 높으면 AM의 분산이 지연되는 경향이 있었다. 강우 기간 동안과 그 이후에는 지상으로부터 바이오에어로졸의 방출이 촉진되고 생장도 증가되며, 풍속과 풍향은 바이오에어로졸의 대기 중 이동에 크게영향을 미친다. 오존, 이산화황, 이산화질소 및 일산화탄소등과 같은 대기오염물질과 미생물의 종 다양성은 상당한 상관관계를 보였다. 그러나, 환경요인들의 영향 메커니즘은 완전히 명확하지 않으므로 향후 AM에 대한 상대적인 연구가더 많이 수행되어야 더 많은 정보를 얻을 수 있을 것이다.

비배양 의존 방법을 이용하여 AM의 메타게놈 특성 연구를 위해서는, 에어로졸 혹은 PM 시료를 채취하고, DNA를추출하여 증폭하고 염기서열을 분석하기 위해 다양한 방법이 이용되고 있다. 그런데 시료 채취 방법에 따라 메타게놈분석 결과의 차이가 있고, DNA 추출 방법과 증폭에 사용하는 primer의 종류는 AM 메타게놈 분석 결과에 영향을 크게미치기 때문에, 관련 연구가 보다 많이 진행되어 분석 방법론이 AM 메타게놈 분석 결과에 미치는 영향을 보다 명확하게 규명하고, 시료 특성에 따른 AM 메타게놈 분석방법을 표준화하는 것이 필요하다.

기존 대기 오염 물질과 함께 바이오에어로졸에 대한 정기적인 모니터링 및 평가는 지속 가능한 사회 및 도시의 발전을 이끌 정책 수립을 위한 중요한 자료로 이용될 수 있다.특히 PM2.5 농도와 PM2.5 중 미생물 메타게놈 분석 정보는 이들로 인한 건강 위해성을 예측하고 예방하는데 활용될 수 있다.

요약

Go to

본 논문에서는 실외 대기 환경의 바이오에어로졸 혹은 입자상물질의 미생물 메타게놈 특성과 이에 영향을 미치는 기후 및 환경 인자의 영향을 고찰하였다. 시료 채취 지역 및 환경 조건 특성별 대기 중 세균과 곰팡이 농도를 요약 하고, 에어로졸과 PM 시료의 세균과 곰팡이의 메타게놈 특성을 조사하기 위한 비배양법 기반 분석방법과 메타게놈 특성을 정리하였다. 또한, 세균과 곰팡이의 메타게놈 특성과 다양성 및특성에 미치는 기상 인자와 환경 인자의 영향을 고찰하였다. 대기 중 미생물의 생존, 생장과 분산은 지역 기상 조건및 대기 오염 물질에 의해 크게 영향을 받았다. 일반적으로기온이 상승함에 따라 AM 농도는 증가하지만, 여름에는 고온과 강한 자외선의 영향으로 AM 농도가 감소하였다. 습도와 미생물 농도는 양의 상관성을 보이나, 습도가 너무 높으면 AM의 분산이 지연되었다. 이러한 종합적인 고찰 결과는대기권에서 미생물의 역할과 기능을 이해하고, 이들 미생물에 의해 야기되는 환경 및 공중보건 문제를 해결하기 위한전략 수립 및 저감 기술 개발에 활용될 수 있다.

References

Go to
  1. Smets W, Moretti S, Denys S, Lebeer S. 2016. Airborne bacteria in the atmosphere: Presence, purpose, and potential. Atmos. Environ. 139: 214-221.
    CrossRef
  2. Yoo K, Lee TK, Choi EJ, Yang J, Shukla SK, Hwang S, et al. 2017. Molecular approaches for the detection and monitoring of microbial communities in bioaerosols: A review. J. Environ. Sci. 51: 234-247.
    Pubmed CrossRef
  3. Zhai Y, Li X, Wang T, Wang B, Li C, Zeng G. 2018. A review on airborne microorganisms in particulate matters: Composition, characteristics and influence factors. Environ. Int. 113: 74-90.
    Pubmed CrossRef
  4. Kathiriya T, Gupta A, Singh NK. 2021. An opinion review on sampling strategies, enumeration techniques, and critical environmental factors for bioaerosols: An emerging sustainability indicator for society and cities. Environ. Technol. Innov. 21: 101287.
    CrossRef
  5. Fröhlichnowoisky J. 2016. Bioaerosols in the earth system: climate, health, and ecosystem interactions. Atmos. Res. 182: 346-376.
    CrossRef
  6. Kim KH, Kabir E, Kabir S. 2015. A review on the human health impact of airborne particulate matter. Environ. Int. 74: 136-143.
    Pubmed CrossRef
  7. Stetzenbach LD, Buttner MP, Cruz P. 2004. Detection and enumeration of airborne biocontaminants. Curr. Opin. Biotechnol. 15: 170-174.
    Pubmed CrossRef
  8. Henderson TJ, Salem H. 2016. CHAPTER 1: The atmosphere: Its developmental history and contributions to microbial evolution and habitat, pp. 1-41. In: Salem H, Katz SA (eds), Aerobiology: The toxicology of airborne pathogens and toxins, 1st Ed. Royal Society of Chemistry, London.
    CrossRef
  9. Gandolfi I, Bertolini V, Ambrosini R, Bestetti G, Franzetti A. 2013. Unravelling the bacterial diversity in the atmosphere. Appl. Microbiol. Biotechnol. 97: 4727-4736.
    Pubmed CrossRef
  10. Jaenicke R. 2005. Abundance of cellular material and proteins in the atmosphere. Science 308: 73.
    Pubmed CrossRef
  11. Brodie EL, DeSantis TZ, Parker JPM, Zubietta IX, Piceno YM, Andersen GL. 2007. Urban aerosols harbor diverse and dynamic bacterial populations. Proc. Natl. Acad. Sci. USA 104: 299-304.
    Pubmed KoreaMed CrossRef
  12. Jones AM, Harrison RM. 2004. The effects of meteorological factors on atmospheric bioaerosol concentrations-a review. Sci. Total Environ. 326: 151-180.
    Pubmed CrossRef
  13. Bertolini V, Gandolfi I, Ambrosini R, Bestetti G, Innocente E, Rampazzo G, et al. 2013. Temporal variability and effect of environmental variables on airborne bacterial communities in an urban area of Northern Italy. Appl. Microbiol. Biotechnol. 97: 6561-6570.
    Pubmed CrossRef
  14. Matthias-Maser S, Obolkin V, Khodzer T, Jaenicke R. 2000. Seasonal variation of primary biological aerosol particles in the remote continental region of Lake Baikal/Siberia. Atmos. Environ. 34: 3805-3811.
    CrossRef
  15. Fahlgren C, Bratbak G, Sandaa R, Thyrhaug R, Zweifel UL. 2011. Diversity of airborne bacteria in samples collected using different devices for aerosol collection. Aerobiologia 27: 107-120.
    CrossRef
  16. Maki T, Susuki S, Kobayashi F, Kakikawa M, Yamada M, Higashi T, et al. 2008. Phylogenetic diversity and vertical distribution of a halobacterial community in the atmosphere of an Asian dust (KOSA) source region, Dunhuang City. Air Qual. Atmos. Health 1: 81-89.
    CrossRef
  17. Maron PA, Lejon DP, Carvalho E, Bizet K, Lemanceau P, Ranjard L, et al. 2005. Assessing genetic structure and diversity of airborne bacterial communities by DNA fingerprinting and 16S rDNA clone library. Atmos. Environ. 39: 3687-3695.
    CrossRef
  18. Barberan A, Henley J, Fierer N, Casamayor EO. 2014. Structure, inter-annual recurrence, and global-scale connectivity of airborne microbial communities. Sci. Total Environ. 487: 187-195.
    Pubmed CrossRef
  19. Maki T, Kakikawa M, Kobayashi F, Yamada M, Matsuki A, Hasegawa H, et al. 2013. Assessment of composition and origin of airborne bacteria in the free troposphere over Japan. Atmos. Environ. 74: 73-82.
    CrossRef
  20. Bottos EM, Woo AC, Zawar-Reza P, Pointing SB, Cary SC. 2014. Airborne bacterial populations above desert soils of the McMurdo dry valleys. Antarctica. Micro. Ecol. 67: 120-128.
    Pubmed KoreaMed CrossRef
  21. DeLeon-Rodriguez N, Lathem TL, Rodriguez-R LM, Barazesh JM, Anderson BE, Beyersdorf AJ, et al. 2013. Microbiome of the upper troposphere: Species composition and prevalence, effects of tropical storms, and atmospheric implications. Proc. Natl. Acad. Sci. USA 110: 2575-2580.
    Pubmed KoreaMed CrossRef
  22. Maier RM, Gentry TJ. 2014. Chapter 17: Microorganisms and organic pollutants, pp. 415-439. In: Pepper I, Gerba C, Gentry T (eds), Environmental Microbiology, 3rd Ed. Academic Press, San Diego, USA.
    CrossRef
  23. Lighthart B. 2000. Mini-review of the concentration variations found in the alfresco atmospheric bacterial populations. Aerobiologia 16: 7-16.
    CrossRef
  24. Georgakopoulos DG, Després V, Fröhlich-Nowoisky J, Psenner R, Ariya PA, Pósfai M, et al. 2009. Microbiology and atmospheric processes: biological, physical and chemical characterization of aerosol particles. Biogeosciences 6: 721-737.
    CrossRef
  25. Deguillaume L, Leriche M, Amato P, Ariya PA, Delort AM, Pöschl U, et al. 2008. Microbiology and atmospheric processes: chemical interactions of primary biological aerosols. Biogeosciences 5: 1073-1084.
    CrossRef
  26. Fierer N, Liu Z, Rodríguez-Hernández M, Knight R, Henn M, Hernandez MT. 2008. Short-term temporal variability in airborne bacterial and fungal populations. Appl. Environ. Microbiol. 74: 200-207.
    Pubmed KoreaMed CrossRef
  27. Ariya PA, Amyot M. 2004. New directions: the role of bioaerosols in atmospheric chemistry and physics. Atmos. Environ. 38: 1231-1233.
    CrossRef
  28. Christner BC, Morris CE, Foreman CM, Cai R, Sands DC. 2008. Ubiquity of biological ice nucleators in snowfall. Science 319: 1214.
    Pubmed CrossRef
  29. Pratt KA, Demott PJ, French JR, Wang Z, Westphal DL, Heymsfield AJ, et al. 2009. In situ detection of biological particles in cloud ice-crystals. Nat. Geosci. 2: 398-401.
    CrossRef
  30. Jones SE, Newton RJ, McMahon KD. 2008. Potential for atmospheric deposition of bacteria to influence bacterioplankton communities. FEMS Microbiol. Ecol. 64: 388-394.
    Pubmed CrossRef
  31. Peter H, Hortnagl P, Reche I, Sommaruga R. 2014. Bacterial diversity and composition during rain events with and without Saharan dust influence reaching a high mountain lake in the Alps. Environ. Microbiol. Rep. 6: 618-624.
    Pubmed KoreaMed CrossRef
  32. Rolph CA, Gwyther CL, Tyrrel SF, Nasir ZA, Drew GH, Jackson SK, et al. 2018. Sources of airborne endotoxins in ambient air and exposure of nearby communities-a review. Atmosphere 9: 375.
    CrossRef
  33. Tang K, Huang Z, Huang J, Maki T, Zhang S, Shimizu A, et al. 2018. Characterization of atmospheric bioaerosols along the transport pathway of Asian dust during the Dust-Bioaerosol 2016 Campaign. Atmos. Chem. Phys. 18: 7131-7148.
    CrossRef
  34. Goudarzi G, Shirmardi M, Khodarahmi F, Hashemi-Shahraki A, Alavi N, Ankali KA, et al. 2014. Particulate matter and bacteria characteristics of the Middle East Dust (MED) storms over Ahvaz, Iran. Aerobiologia 30: 345-356.
    CrossRef
  35. Li Y, Fu H, Wang W, Liu J, Meng Q, Wang W. 2015. Characteristics of bacterial and fungal aerosols during the autumn haze days in Xi'an, China. Atmos. Environ. 122: 439-447.
    CrossRef
  36. Fang Z, Yao W, Lou X, Hao C, Gong C, Ouyang Z. 2016. Profile and characteristics of culturable airborne bacteria in Hangzhou, Southeast of China. Aerosol Air Qual. Res. 16: 1690-1700.
    CrossRef
  37. Gao M, Yan X, Qiu T, Han M, Wang X. 2016. Variation of correlations between factors and culturable airborne bacteria and fungi. Atmos. Environ. 128: 10-19.
    CrossRef
  38. Ji L, Zhang Q, Fu X, Zheng L, Dong J, Wang J, Guo S. 2019. Feedback of airborne bacterial consortia to haze pollution with different PM2.5 levels in typical mountainous terrain of Jinan, China. Sci. Total Environ. 695: 133912.
    Pubmed CrossRef
  39. Bowers RM, McLetchie S, Knight R, Fierer N. 2011. Spatial variability in airborne bacterial communities across land-use types and their relationship to the bacterial communities of potential source environments. ISME J. 5: 601-612.
    Pubmed KoreaMed CrossRef
  40. Bowers RM, McCubbin IB, Hallar AG, Fierer N. 2012. Seasonal variability in airborne bacterial communities at a high-elevation site. Atmos. Environ. 50: 41-49.
    CrossRef
  41. Dong L, Qi J, Shao C, Zhong X, Gao D, Cao W, et al. 2016. Concentration and size distribution of total airborne microbes in hazy and foggy weather. Sci. Total Environ. 541: 1011-1018.
    Pubmed CrossRef
  42. Murata K, Zhang D. 2016. Concentration of bacterial aerosols in response to synoptic weather and land-sea breeze at a seaside site downwind of the Asian continent. J. Geophys. Res. Atmos. 121: 11636-11647.
    CrossRef
  43. Genitsaris S, Stefanidou N, Katsiapi M, Kormas KA, Sommer U, Moustaka-Gouni M. 2017. Variability of airborne bacteria in an urban Mediterranean area (Thessaloniki, Greece). Atmos. Environ. 157: 101-110.
    CrossRef
  44. Liu H, Zhang X, Zhang H, Yao X, Zhou M, Wang J, et al. 2018. Effect of air pollution on the total bacteria and pathogenic bacteria in different sizes of particulate matter. Environ. Pollut. 233: 483-493.
    Pubmed CrossRef
  45. Liu T, Chen LWA, Zhang M, Watson JG, Chow JC, Cao J, et al. 2019. Bioaerosol concentrations and size distributions during the autumn and winter seasons in an industrial city of central China. Aerosol Air Qual. Res. 19: 1095-1104.
    CrossRef
  46. Bai W, Li Y, Xie W, Ma T, Hou J, Zeng X. 2021. Vertical variations in the concentration and community structure of airborne microbes in PM2.5. Sci. Total Environ. 760: 143396.
    Pubmed CrossRef
  47. Lee SH, Lee HJ, Kim SJ, Lee HM, Kang H, Kim YP. 2010. Identification of airborne bacterial and fungal community structures in an urban area by T-RFLP analysis and quantitative real-time PCR. Sci. Total Environ. 408: 1349-1357.
    Pubmed CrossRef
  48. Tanaka D, Terada Y, Nakashima T, Sakatoku A, Nakamura S. 2015. Seasonal variations in airborne bacterial community structures at a suburban site of central Japan over a 1-year time period using PCR-DGGE method. Aerobiologia 31: 143-157.
    CrossRef
  49. Gao JF, Fan XY, Li HY, Pan KL. 2017. Airborne bacterial communities of PM2.5 in Beijing-Tianjin-Hebei megalopolis, China as revealed by Illumina MiSeq sequencing: A case study. Aerosol Air Qual. Res. 17: 788-798.
    CrossRef
  50. Wei M, Xu C, Xu X, Zhu C, Li J, Lv G. 2019. Characteristics of atmospheric bacterial and fungal communities in PM2.5 following biomass burning disturbance in a rural area of North China Plain. Sci. Total Environ. 651: 2727-2739.
    Pubmed CrossRef
  51. Wei M, Liu H, Chen J, Xu C, Li J, Xu P, Sun Z. 2020. Effects of aerosol pollution on PM2.5-associated bacteria in typical inland and coastal cities of northern China during the winter heating season. Environ. Pollut. 262: 114188.
    Pubmed CrossRef
  52. Klappenbach JA, Saxman PR, Cole JR, Schmidt TM. 2001. rrndb: the ribosomal RNA operon copy number database. Nucleic Acids Res. 29: 181-184.
    Pubmed KoreaMed CrossRef
  53. Van Doorn R, Szemes M, Bonants P, Kowalchuk GA, Salles JF, Ortenberg E, et al. 2007. Quantitative multiplex detection of plant pathogens using a novel ligation probe-based system coupled with universal, high-throughput real-time PCR on OpenArrays™. BMC Genomics 8: 276.
    Pubmed KoreaMed CrossRef
  54. Raisi L, Aleksandropoulou V, Lazaridis M, Katsivela E. 2013. Size distribution of viable, cultivable, airborne microbes and their relationship to particulate matter concentrations and meteorological conditions in a Mediterranean site. Aerobiologia 29: 233-248.
    CrossRef
  55. Gordon J, Gandhi P, Shekhawat G, Frazier A, Hampton-Marcell J, Gilbert JA. 2015. A simple novel device for air sampling by electrokinetic capture. Microbiome 3: 79.
    Pubmed KoreaMed CrossRef
  56. Mbareche H, Veillette M, Bilodeau GJ, Duchaine C. 2018. Bioaerosol sampler choice should consider efficiency and ability of samplers to cover microbial diversity. Appl. Environ. Microbiol. 84: 1589-1607.
    Pubmed KoreaMed CrossRef
  57. Haig CW, Mackay WG, Walker JT, Williams C. 2016. Bioaerosol sampling: sampling mechanisms, bio-efficiency and field studies. J. Hosp. Infect. 93: 242-255.
    Pubmed KoreaMed CrossRef
  58. Núñez A, Amo de Paz G, Rastrojo A, García AM, Alcamí A, Gutiérrez-Bustillo AM, et al. 2016. Monitoring of airborne biological particles in outdoor atmosphere. Part 1: Importance, variability and ratios. Int. Microbiol. 19: 1-13.
  59. Du P, Du R, Ren W, Lu Z, Fu P. 2018b. Seasonal variation characteristic of inhalable microbial communities in PM2.5 in Beijing city, China. Sci. Total Environ. 610-611: 308-315.
    Pubmed CrossRef
  60. Cao C, Jiang WJ, Wang BY, Fang JH, Lang JD, Tian G, Jiang JK, Zhu TF. 2014. Inhalable microorganisms in Beijing's PM2.5 and PM10 pollutants during a severe smog event. Environ. Sci. Technol. 48: 1499-1507.
    Pubmed KoreaMed CrossRef
  61. Pan Y, Luo L, Xiao H, Zhu R, Xiao H. 2020. Spatial variability of inhalable fungal communities in airborne PM2.5 across Nanchang, China. Sci. Total Environ. 746: 141171.
    Pubmed CrossRef
  62. Du P, Du R, Ren W, Lu Z, Zhang Y, Fu P. 2018a. Variations of bacteria and fungi in PM2.5 in Beijing, China. Atmos. Environ. 172: 55-64.
    CrossRef
  63. Radosevich JL, Wilson WJ, Shinn JH, DeSantis TZ, Andersen GL. 2002. Development of a high-volume aerosol collection system for the identification of air-borne micro-organisms. Appl. Microbiol. 34: 162-167.
    Pubmed CrossRef
  64. Li H, Shan Y, Huang Y, An Z, Xu G, Wei F, Zhang C, Wu W. 2019. Bacterial community specification in PM2.5 in different seasons in Xinxiang, central China. Aerosol Air Qual. Res. 19: 1355-1364.
    CrossRef
  65. Fröhlich-Nowoisky J, Pickersgill DA, Despres VR, Poschla U. 2009. High diversity of fungi in air particulate matter. PNAS 106: 12814-12819.
    Pubmed KoreaMed CrossRef
  66. Chen H, Du R, Zhang Y, Zhang S, Ren W, Du P. 2021. Survey of background microbial index in inhalable particles in Beijing. Sci. Total Environ. 757: 143743.
    Pubmed CrossRef
  67. Fan XY, Gao JF, Pan KL, Li DC, Dai HH, Li X. 2019. More obvious air pollution impacts on variations in bacteria than fungi and their co-occurrences with ammonia-oxidizing microorganisms in PM2.5. Environ. Pollut. 251: 668-680.
    Pubmed CrossRef
  68. Zhong S, Zhang L, Jiang X, Gao P. 2019. Comparison of chemical composition and airborne bacterial community structure in PM2.5 during haze and non-haze days in the winter in Guilin, China. Sci. Total Environ. 655: 202-210.
    Pubmed CrossRef
  69. Qi Y, Li Y, Xie W, Lu R, Mu F, Bai W, Du S. 2020. Temporal-spatial variations of fungal composition in PM2.5 and source tracking of airborne fungi in mountainous and urban regions. Sci. Total Environ. 708: 135027.
    Pubmed CrossRef
  70. Park EH, Heo J, Kim H, Yi SM. 2020. The major chemical constituents of PM2.5 and airborne bacterial community phyla in Beijing, Seoul, and Nagasaki. Chemosphere 254: 126870.
    Pubmed CrossRef
  71. Puspitasari F, Maki T, Shi G, Bin C, Kobayashi F, Hasegawa H, et al. 2016. Phylogenetic analysis of bacterial species compositions in sand dunes and dust aerosol in an Asian dust source area, the Taklimakan desert. Air Qual. Atmos. Heal. 9: 631-644.
    CrossRef
  72. Lee JY, Park EH, Lee S, Ko G, Honda Y, Hashizume M, et al. 2017. Airborne bacterial communities in three East Asian Cities of China, South Korea, and Japan. Sci. Rep. 7: 5545.
    Pubmed KoreaMed CrossRef
  73. Williams RH, Ward E, McCartney HA. 2001. Methods for Integrated air sampling and DNA analysis for detection of airborne fungal spores. Appl. Environ. Microbiol. 67: 2453-2459.
    Pubmed KoreaMed CrossRef
  74. Yooseph S, Andrews-Pfannkoch C, Tenney A, McQuaid J, Williamson S, Thiagarajan M, et al. 2013. A metagenomic framework for the study of airborne microbial communities. PLoS One 8: e81862.
    Pubmed KoreaMed CrossRef
  75. Vokou D, Vareli K, Zarali E, Karamanoli K, Constantinidou HIA, Monokrousos N, et al. 2012. Exploring biodiversity in the bacterial community of the mediterranean phyllosphere and its relationship with airborne bacteria. Microb. Ecol. 64: 714-724.
    Pubmed CrossRef
  76. Sánchez-Parra B, Núñez A, García AM, Campoy P, Moreno DA. 2021. Distribution of airborne pollen, fungi and bacteria at four altitudes using high-throughput DNA sequencing. Atmos. Res. 249: 105306.
    CrossRef
  77. Serrano-Silva N, Calderon-Ezquerro MC. 2018. Metagenomic survey of bacterial diversity in the atmosphere of Mexico city using different sampling methods. Environ. Pollut. 235: 20-29.
    Pubmed CrossRef
  78. Kraaijeveld K, De Weger LA, García MV, Buermans H, Frank J, Hiemstra PS, et al. 2015. Efficient and sensitive identification and quantification of airborne pollen using next-generation DNA sequencing. Mol. Ecol. Resour. 15: 8-16.
    Pubmed CrossRef
  79. Seifried JS, Wichels A, Gerdts G. 2015. Spatial distribution of marine airborne bacterial communities. Microbiologyopen 4: 475-490.
    Pubmed KoreaMed CrossRef
  80. Tate KG, Ogawa JM, Yates WE, Sturgeon G. 1980. Performance of a cyclone spore trap. Phytopathology 70: 285-290.
    CrossRef
  81. Lindsley WG, Green BJ, Bleacher FM, Martin SB, Law BF, Jensen PA, Schafer MP. 2017. Sampling and characterization of bioaerosols, pp. BA1-115. In: Ashley K, O'Connor PF (eds), NIOSH Manual of Analytical Methods, 5th Ed. National Institute for Occupational Safety and Health (NIOSH), USA.
  82. Mainelis G. 2020. Bioaerosol sampling: Classical approaches, advances, and perspectives. Aerosol Sci. Technol. 54: 496-519.
    CrossRef
  83. Matsuda S, Kawashima S. 2018. Relationship between laser light scattering and physical properties of airborne pollen. J. Aerosol Sci. 124: 122-132.
    CrossRef
  84. Yao M, Mainelis G. 2006. Investigation of cut-off sizes and collection efficiencies of portable microbial samplers. Aerosol Sci. Technol. 40: 595-606.
    CrossRef
  85. Guo F, Zhang T. 2013. Biases during DNA extraction of activated sludge samples revealed by high throughput sequencing. Appl. Microbiol. Biotechnol. 97: 4607-4616.
    Pubmed KoreaMed CrossRef
  86. Mescioglu E, Paytan A, Mitchell BW, Griffin DW. 2021. Efficiency of bioaerosol samplers: a comparison study. Aerobiologia 37: 447-459.
    CrossRef
  87. Aguayo J, Fourrier-Jeandel C, Husson C, Loos R. 2018. Assessment of passive traps combined with high-throughput. Appl. Environ. Microbiol. 84: e02637-17.
    Pubmed KoreaMed CrossRef
  88. Wei K, Zou Z, Zheng Y, Li J, Shen F, Wu C, et al. 2016. Ambient bioaerosol particle dynamics observed during haze and sunny days in Beijing. Sci. Total Environ. 550: 751-759.
    Pubmed CrossRef
  89. Johnson MD, Cox RD, Barnes MA. 2019. Analyzing airborne environmental DNA: A comparison of extraction methods, primer type, and trap type on the ability to detect airborne eDNA from terrestrial plant communities. Environ. DNA 1: 176-185.
    CrossRef
  90. Luhung I, Wu Y, Ng CK, Miller D, Cao B, Chang VW-C. 2015. Protocol improvements for low concentration DNA-based bioaerosol sampling and analysis. PLoS One 10: e0141158.
    Pubmed KoreaMed CrossRef
  91. Hospodsky D, Yamamoto N, Peccia J. 2010. Accuracy, precision, and method detection limits of quantitative PCR for airborne bacteria and fungi. Appl. Environ. Microbiol. 76: 7004-7012.
    Pubmed KoreaMed CrossRef
  92. Innis MA. 1990. PCR protocols?: a guide to methods and applications, pp. 311-316. In: , 1st Ed. Academic Press, Massachusetts, USA.
  93. Nossa CW. 2010. Design of 16S rRNA gene primers for 454 pyrosequencing of the human foregut microbiome. World J. Gastroenterol. 16: 4135.
    Pubmed KoreaMed CrossRef
  94. Singh J, Birbian N, Sinha S, Goswami A. 2014. A critical review on PCR, its types and applications. Int. J. Adv. Res. Biol. Sci. 1: 65-80.
  95. Abellan-Schneyder I, Matchado MS, Reitmeier S, Sommer A, Sewald Z, Baumbach J, et al. 2021. Primer, pipelines, parameters: Issues in 16S rRNA gene sequencing. Msphere 6: e01202-20.
    Pubmed KoreaMed CrossRef
  96. Madsen AM, Zervas A, Tendal K, Nielsen JL. 2015. Microbial diversity in bioaerosol samples causing ODTS compared to reference bioaerosol samples as measured using Illumina sequencing and MALDI-TOF. Environ. Res. 140: 255-267.
    Pubmed CrossRef
  97. Woo AC, Brar MS, Chan Y, Lau MC, Leung FC, Scott JA, et al. 2013. Temporal variation in airborne microbial populations and microbially-derived allergens in a tropical urban landscape. Atmos. Environ. 74: 291-300.
    CrossRef
  98. Leontidou K, Vernesi C, De Groeve J, Cristofolini F, Vokou D, Cristofori A. 2018. DNA metabarcoding of airborne pollen: new protocols for improved taxonomic identification of environmental samples. Aerobiologia 34: 63-74.
    CrossRef
  99. Aziza AA, Lee K, Park B, Park H, Park K, Choi IG, et al. 2018. Comparative study of the airborne microbial communities and their functional composition in fine particulate matter (PM2.5) under non-extreme and extreme PM2.5 conditions. Atmos. Environ. 194: 82-92.
    CrossRef
  100. Maki T, Hara K, Kobayashi F, Kurosaki Y, Kakikawa M, Matsuki A, et al. 2015. Vertical distribution of airborne bacterial communities in an Asian-dust downwind area, Noto Peninsula. Atmos. Environ. 119: 282-293.
    CrossRef
  101. Campa AS, García-Salamanca A, Solano J, Rosa J, Ramos J. 2013. Chemical and microbiological characterization of atmospheric particulate matter during an intense African dust event in southern Spain. Environ. Sci. Technol. 47: 3630-3638.
    Pubmed CrossRef
  102. Haas D, Défago G. 2005. Biological control of soil-borne pathogens by fluorescent Pseudomonads. Nat. Rev. Microbiol. 3: 307-319.
    Pubmed CrossRef
  103. Xu C, Wei M, Chen J, Wang X, Zhu C, Li J, et al. 2017. Bacterial characterization in ambient submicron particles during severe haze episodes at Ji'nan, China. Sci. Total Environ. 580: 188-196.
    Pubmed CrossRef
  104. Hu J, He XH, Li DP, Liu Q. 2007. Progress in research of Spingomonas. Chin. J. Appl. Environ. Biol. 13: 431-437.
  105. Gandolfi I, Bertolini V, Bestetti G, Ambrosini R, Innocente E, Rampazzo G, et al. 2015. Spatio-temporal variability of airborne bacterial communities and their correlation with particulate matter chemical composition across two urban areas. Appl. Microbiol. Biotechnol. 99: 4867-4877.
    Pubmed CrossRef
  106. Federici E, Petroselli C, Montalbani E, Casagrande C, Ceci E, Moroni B, et al. 2018. Airborne bacteria and persistent organic pollutants associated with an intense Saharan dust event in the Central Mediterranean. Sci. Total Environ. 645: 401-410.
    Pubmed CrossRef
  107. Awad AHA, Elmorsy TH, Tarwater PM, Green CF, Gibbs SG. 2010. Air biocontamination in a variety of agricultural industry environments in Egypt: a pilot study. Aerobiologia 26: 223-232.
    CrossRef
  108. Gangamma S. 2014. Characteristics of airborne bacteria in Mumbai urban environment. Sci. Total Environ. 488-489: 70-74.
    Pubmed CrossRef
  109. Gao M, Qiu T, Jia R, Han M, Song Y, Wang X. 2015. Concentration and size distribution of viable bioaerosols during nonhaze and haze days in Beijing. Environ. Sci. Pollut. Res. Int. 22: 4359-4368.
    Pubmed CrossRef
  110. Yan D, Zhang T, Su J, Zhao LL, Wang H, Fang XM, et al. 2016. Diversity and composition of airborne fungal community associated with particulate matters in Beijing during haze and non-haze days. Front. Microbiol. 7: 487.
    CrossRef
  111. Li Y, Lu R, Li W, Xie Z, Song Y. 2017. Concentrations and size distributions of viable bioaerosols under various weather conditions in a typical semi-arid city of Northwest China. J. Aerosol Sci. 106: 83-92.
    CrossRef
  112. Xie Z, Li Y, Lu R, Li W, Fan C, Liu P, et al. 2018. Characteristics of total airborne microbes at various air quality levels. J. Aerosol Sci. 116: 57-65.
    CrossRef
  113. Li J, Chen H, Li X, Wang M, Zhang X, Cao J, et al. 2019. Differing toxicity of ambient particulate matter (PM) in global cities. Atmos. Environ. 212: 305-315.
    CrossRef
  114. Tong Y. 1999. Diurnal distribution of total and culturable atmospheric bacteria at a rural site. Aerosol Sci. Technol. 30: 246-254.
    CrossRef
  115. Fang Z, Ouyang Z, Zheng H, Wang X, Hu L. 2007. Culturable airborne bacteria in outdoor environments in Beijing, China. Microb. Ecol. 54: 487-496.
    Pubmed CrossRef
  116. Zheng WC, Zhao Y, Xin HW, Li BM, Gates R. 2013. Concentrations and size distributions of airborne particulate matter and bacteria in an experimental aviary laying-hen chamber. Trans. ASABE 56: 1493-1501.
    CrossRef
  117. Garaga R, Avinash CKR, Kota SH. 2019. Seasonal variation of airborne allergenic fungal spores in ambient PM 10-a study in Guwahati, the largest city of north-east India. Air Qual. Atmos. Health. 12: 11-20.
    CrossRef
  118. Rathnayake CM, Metwali N, Jayarathne T, Kettler J, Huang Y, Thorne PS, et al. 2017. Influence of rain on the abundance of bioaerosols in fine and coarse particles. Atmos. Chem. Phys. 17: 2459-2475.
    CrossRef
  119. Kumar P, Mahor P, Goel AK, Kamboj DV, Kumar O. 2011. Aeromicrobiological study on distribution pattern of bacteria and fungi during weekdays at two different locations in urban atmosphere of Gwalior, Central India. Sci. Res. Essays 6: 5435-5441.
  120. Spasojevic MJ, Grace JB, Harrison S, Damschen EI. 2014. Functional diversity supports the physiological tolerance hypothesis for plant species richness along climatic gradients. J. Ecol. 102: 447-455.
    CrossRef
  121. Brągoszewska E, Pastuszka JS. 2018. Influence of meteorological factors on the level and characteristics of culturable bacteria in the air in Gliwice, Upper Silesia (Poland). Aerobiologia 34: 241-255.
    Pubmed KoreaMed CrossRef
  122. Kowalski M, Pastuszka JS. 2017. Effect of ambient air temperature and solar radiation on changes in bacterial and fungal aerosols concentration in the urban environment. Ann. Agric. Environ. Med. AAEM. 25: 259-261.
    Pubmed CrossRef
  123. Naruka K, Heda S. 2018. A preliminary study on fungal air spora at railway station with special reference to summer season. Int. Res. J. Environ. Sci. 7: 52-55.
  124. Kumar A, Attri AK. 2016. Characterization of fungal spores in ambient particulate matter: a study from the Himalayan region. Atmos. Environ. 142: 182-193.
    CrossRef
  125. Chakrabarti HS, Das S, Gupta-Bhattacharya S. 2012. Outdoor airborne fungal spora load in a suburb of kolkata, India: its variation, meteorological determinants and health impact. Int. J. Environ. Health Res. 22: 37-50.
    Pubmed CrossRef
  126. Tang JW. 2009. The effect of environmental parameters on the survival of airborne infectious agents. J. R. Soc. Interface 6: S737-S746.
    CrossRef
  127. Alghamdi MA, Shamy M, Redal MA, Khoder M, Awad AH, Elserougy S. 2014. Microorganisms associated particulate matter: a preliminary study. Sci. Total Environ. 479-480: 109-116.
    Pubmed CrossRef
  128. Almaguer M, Aira MJ, Rodriguez-Rajo FJ, Rojas TI. 2014. Temporal dynamics of airborne fungi in Havana (Cuba) during dry and rainy seasons: influence of meteorological parameters. Int. J. Biometeorol. 58: 1459-1470.
    Pubmed CrossRef
  129. Quintero E, Rivera-Mariani F, Bolaños-Rosero B. 2009. Analysis of environmental factors and their effects on fungal spores in the atmosphere of a tropical urban area (San Juan, Puerto Rico). Aerobiologia 26: 113-124.
    CrossRef
  130. Rivera-Mariani FE, Bolaños-Rosero B. 2012. Allergenicity of airborne basidiospores and ascospores: need for further studies. Aerobiologia 28: 83-97.
    CrossRef
  131. Fröhlichnowoisky J, Ruzene Nespoli C, Pickersgill DA, Galand PE, Müllergermann I, Nunes T. 2014. Diversity and seasonal dynamics of airborne archaea. Biogeosciences 11: 6067-6079.
    CrossRef
  132. Sousa SIV, Martins FG, Pereira MC, Alvim-Ferraz MCM, Ribeiro H, Oliveira M, et al. 2008. Influence of atmospheric ozone, PM10 and meteorological factors on the concentration of airborne pollen and fungal spores. Atmos. Environ. 42: 7452-7464.
    CrossRef
  133. Zhen Q, Deng Y, Wang Y, Wang X, Zhang H, Sun X, et al. 2017. Meteorological factors had more impact on airborne bacterial communities than air pollutants. Sci. Total Environ. 601-602: 703-712.
    Pubmed CrossRef
  134. Lu R, Li Y, Li W, Xie Z, Fan C, Liu P, et al. 2018. Bacterial community structure in atmospheric particulate matters of different sizes during the haze days in Xi'an, China. Sci. Total Environ. 637-638: 244-252.
    Pubmed CrossRef
  135. Erkara IP, Asan A, Yilmaz V, Pehlivan S, Okten SS. 2008. Airborne Alternaria and Cladosporium species and relationship with meteorological conditions in Eskisehir City, Turkey. Environ. Monit. Assess. 144: 31-41.
    Pubmed CrossRef
  136. Hollins PD, Kettlewell PS, Atkinson MD, Stephenson DB, Corden JM, Millington WM, et al. 2004. Relationships between airborne fungal spore concentration of Cladosporium and the summer climate at two sites in Britain. Int. J. Biometeorol. 48: 137-141.
    Pubmed CrossRef
  137. Umesh BK. 2014. Study of biodiversity of fungal bioaerosols in mumbai Metropolis. Int. J. Res. Biosci. Agric. Technol. 2: 193-2015.
  138. Xu C, Wei M, Chen J, Zhu C, Li J, Lv G, et al. 2017. Fungi diversity in PM2.5 and PM1 at the summit of Mt. Tai: abundance, size distribution, and seasonal variation. Atmos. Chem. Phys. 17: 1147-11260.
  139. Knudsen SM, Gunnarsen L, Madsen AM. 2017. Airborne fungal species associated with mouldy and non-mouldy buildings -effects of air change rates, humidity, and air velocity. Build. Sci. 122: 161-170.
    CrossRef
  140. Corden JM, Millington WM. 2001. The long-term trends and seasonal variation of the aeroallergen alternaria in derby. Aerobiologia 17: 127-136.
    CrossRef
  141. Grinn-Gofroń A, Nowosad J, Bosiacka B, Camacho I, Pashley C, Belmonte J, et al. 2019. Airborne alternaria and cladosporium fungal spores in europe: Forecasting possibilities and relationships with meteorological parameters. Sci. Total Environ. 653: 938-946.
    Pubmed CrossRef
  142. Li DW, Kendrick B. 1995. A year-round study on functional relationships of airborne fungi with meteorological factors. Int. J. Biometeorol. 39: 74-80.
    Pubmed CrossRef
  143. Savage D, Barbetti MJ, MacLeod WJ, Salam MU, Renton M. 2012. Mobile traps are better than stationary traps for surveillance of airborne fungal spores. Crop Prot. 36: 23-30.
    CrossRef
  144. Zhong X, Qi J, Li H, Dong L, Gao D. 2016. Seasonal distribution of microbial activity in bioaerosols in the outdoor environment of the Qingdao coastal region. Atmos. Environ. 140: 506-513.
    CrossRef
  145. Sabariego S, Díaz DLGC, Alba F. 2000. The effect of meteorological factors on the daily variation of airborne fungal spores in Granada (southern Spain). Int. J. Biometeorol. 44: 1-5.
    Pubmed CrossRef
  146. Stennett PJ, Beggs PJ. 2004. Alternaria spores in the atmosphere of Sydney, Australia, and relationships with meteorological factors. Int. J. Biometeorol. 49: 98-105.
    Pubmed CrossRef
  147. Crandall SG, Gilbert GS. 2017. Meteorological factors associated with abundance of airborne fungal spores over natural vegetation. Atmos. Environ. 162: 87-99.
    CrossRef
  148. Harrison RM, Jones AM, Biggins PD, Pomeroy N, Cox CS, Kidd SP, et al. 2005. Climate factors influencing bacterial count in background air samples. Int. J. Biometeorol. 49: 167-178.
    Pubmed CrossRef
  149. Ma J, Sun J, Zhang T, Zeng J, Lin Q, Deng L, et al. 2011. Effect of partial solar eclipse on airborne culturable bacterial community in Urumqi. Acta Ecol. Sin. 31: 4671-4679.
  150. Mouli PC, Mohan SV, Reddy SJ. 2005. Assessment of microbial (bacteria) concentrations of ambient air at semi-arid urban region: influence of meteorological factors. Appl. Ecol. Environ. Res. 3: 139-149.
    CrossRef
  151. Raisi L, Lazaridis M, Katsivela E. 2010. Relationship between airborne microbial and particulate matter concentrations in the ambient air at a Mediterranean site. Global NEST J. 12: 84-91.
    CrossRef
  152. Wu YH, Chan CC, Chew GL, Shih PW, Lee CT, Chao HJ. 2012. Meteorological factors and ambient bacterial levels in a subtropical urban environment. Int. J. Biometeorol. 56: 1001-1009.
    Pubmed CrossRef
  153. Murray BJ, Ross JF, Whale TF, Price HC, Atkinson JD, Umo NS, et al. 2015. The relevance of nanoscale biological fragments for ice nucleation in clouds. Sci. Rep. 5: 8082.
    Pubmed KoreaMed CrossRef
  154. Schumacher CJ, Pöhlker C, Aalto P, Hiltunen V, Petäjä T, Kulmala M, et al. 2013. Seasonal cycles of fluorescent biological aerosol particles in boreal and semi-arid forests of finland and colorado. Atmos. Chem. Phys. 13: 11987-12001.
    CrossRef
  155. Huffman JA, Prenni AJ, DeMott PJ, Pöhlker C, Mason RH, Robinson NH, et al. 2013. High concentrations of biological aerosol particles and ice nuclei during and after rain. Atmos. Chem. Phys. 13: 6151-6164.
    CrossRef
  156. RodrÍGuez-Rajo FJ, Iglesias I, Jato V. 2005. Variation assessment of airborne alternaria and Cladosporium spores at different bioclimatical conditions. Mycol. Res. 109: 497-507.
    Pubmed CrossRef
  157. Elbert W, Taylor PE, Andreae MO, Pöschl U. 2006. Contribution of fungi to primary biogenic aerosols in the atmosphere: wet and dry discharged spores, carbohydrates, and inorganic ions by Asco- and Basidiomycota. Atmos. Chem. Phys. Discuss. 6: 11317-11355.
    CrossRef
  158. Allitt U. 2000. Airborne fungal spores and the thunderstorm of 24 June 1994. Aerobiologia 16: 397.
    CrossRef
  159. Hai VD, Hoang SMT, Hung NTQ, Ky NM, Gwi-Nam B, Ki-hong P, et al. 2019. Characteristics of airborne bacteria and fungi in the atmosphere in Ho Chi Minh city, Vietnam-a case study over three years. Int. Biodeterior. Biodegrad. 145: 104819.
    CrossRef
  160. Li M, Qi J, Zhang H, Huang S, Li L, Gao D. 2011. Concentration and size distribution of bioaerosols in an outdoor environment in the Qingdao coastal region. Sci. Total Environ. 409: 3812-3819.
    Pubmed CrossRef
  161. Fan C, Li Y, Liu P, Mu F, Xie Z, Lu R, et al. 2019. Characteristic of airborne opportunistic pathogenic bacteria during autumn and winter in Xi'an, China. Sci. Total Environ. 672: 834-845.
    Pubmed CrossRef
  162. Wang BB, Li YP, Xie ZS, Du SL, Zeng XL, Hou JL, et al. 2020. Characteristics of microbial activity in atmospheric aerosols and its relationship to chemical composition of PM2.5 in Xi'an, China. J. Aerosol Sci. 146: 105572.
    CrossRef
  163. Qin N, Liang P, Wu CY, Wang GQ, Xu Q, Xiong X, et al. 2020. Longitudinal survey of microbiome associated with particulate matter in a megacity. Genome Biol. 21: 55.
    Pubmed KoreaMed CrossRef
  164. Sun Y, Xu S, Zheng D, Li J, Tian H, Wang Y. 2018. Effects of haze pollution on microbial community changes and correlation with chemical components in atmospheric particulate matter. Sci. Total Environ. 637-638: 507-516.
    Pubmed CrossRef
  165. Li W, Yang J, Zhang D, Li B, Wang E, Yuan H. 2018. Concentration and community of airborne bacteria in response to cyclical haze events during the fall and winter in Beijing, China. Front. Microbiol. 9: 1741.
    Pubmed KoreaMed CrossRef
  166. Tan J, Duan J, Zhen N, He K, Hao J. 2016. Chemical characteristics and source of size ractionated atmospheric particle in haze episode in Beijing. Atmos. Res. 167: 24-33.
    CrossRef
  167. Bell ML, Dominici F, Ebisu K, Zeger SL, Samet JM. 2007. Spatial and temporal variation in PM2.5 chemical composition in the United States for health effects studies. Environ. Health Perspect. 115: 989-995.
    Pubmed KoreaMed CrossRef
  168. Yan R, Yu S, Zhang Q, Li P, Wang S, Chen B, et al. 2015. A heavy haze episode in Beijing in February of 2014: Characteristics, origins and implications. Atmos. Pollut. Res. 6: 867-876.
    CrossRef
  169. Stillore AD, Trueblood JV, Grassian VH. 2016. Atmospheric chemistry of bioaerosols: heterogeneous and multiphase reactions with atmospheric oxidants and other trace gases. Chem. Sci. 7: 6604-6616.
    Pubmed KoreaMed CrossRef

Article Tools

Starts of Metrics

Share this article on :

Related articles in MBL

Most Searched Keywords ?

What is Most Searched Keywords?

  • It is most registrated keyword in articles at this journal during for 2 years.